ID: 1054417423

View in Genome Browser
Species Human (GRCh38)
Location 9:64890158-64890180
Sequence ACTGCAGCTCAGTCCCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054417423_1054417430 24 Left 1054417423 9:64890158-64890180 CCTGGATGGGACTGAGCTGCAGT No data
Right 1054417430 9:64890205-64890227 ACTTGGCTGAGTAGAGCAGATGG No data
1054417423_1054417426 -1 Left 1054417423 9:64890158-64890180 CCTGGATGGGACTGAGCTGCAGT No data
Right 1054417426 9:64890180-64890202 TTCTCTCCCTTGGACTGAGAGGG No data
1054417423_1054417425 -2 Left 1054417423 9:64890158-64890180 CCTGGATGGGACTGAGCTGCAGT No data
Right 1054417425 9:64890179-64890201 GTTCTCTCCCTTGGACTGAGAGG No data
1054417423_1054417429 7 Left 1054417423 9:64890158-64890180 CCTGGATGGGACTGAGCTGCAGT No data
Right 1054417429 9:64890188-64890210 CTTGGACTGAGAGGGAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054417423 Original CRISPR ACTGCAGCTCAGTCCCATCC AGG (reversed) Intergenic
No off target data available for this crispr