ID: 1054420349

View in Genome Browser
Species Human (GRCh38)
Location 9:64922792-64922814
Sequence CAGGCGTGAGCCACCATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 555556
Summary {0: 7414, 1: 43495, 2: 117154, 3: 175476, 4: 212017}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054420349_1054420350 -6 Left 1054420349 9:64922792-64922814 CCAGGCATGGTGGCTCACGCCTG 0: 7414
1: 43495
2: 117154
3: 175476
4: 212017
Right 1054420350 9:64922809-64922831 CGCCTGTAATCCCAGCACCTTGG 0: 1093
1: 125821
2: 295443
3: 377034
4: 296464
1054420349_1054420360 26 Left 1054420349 9:64922792-64922814 CCAGGCATGGTGGCTCACGCCTG 0: 7414
1: 43495
2: 117154
3: 175476
4: 212017
Right 1054420360 9:64922841-64922863 ATGGGTAAATCATCTGAGGTCGG No data
1054420349_1054420357 8 Left 1054420349 9:64922792-64922814 CCAGGCATGGTGGCTCACGCCTG 0: 7414
1: 43495
2: 117154
3: 175476
4: 212017
Right 1054420357 9:64922823-64922845 GCACCTTGGGAGGCTGAGATGGG 0: 39
1: 2958
2: 44337
3: 174208
4: 366864
1054420349_1054420361 27 Left 1054420349 9:64922792-64922814 CCAGGCATGGTGGCTCACGCCTG 0: 7414
1: 43495
2: 117154
3: 175476
4: 212017
Right 1054420361 9:64922842-64922864 TGGGTAAATCATCTGAGGTCGGG No data
1054420349_1054420356 7 Left 1054420349 9:64922792-64922814 CCAGGCATGGTGGCTCACGCCTG 0: 7414
1: 43495
2: 117154
3: 175476
4: 212017
Right 1054420356 9:64922822-64922844 AGCACCTTGGGAGGCTGAGATGG 0: 49
1: 4824
2: 75181
3: 175893
4: 186482
1054420349_1054420351 -5 Left 1054420349 9:64922792-64922814 CCAGGCATGGTGGCTCACGCCTG 0: 7414
1: 43495
2: 117154
3: 175476
4: 212017
Right 1054420351 9:64922810-64922832 GCCTGTAATCCCAGCACCTTGGG 0: 2113
1: 221635
2: 313142
3: 352277
4: 351198
1054420349_1054420353 -2 Left 1054420349 9:64922792-64922814 CCAGGCATGGTGGCTCACGCCTG 0: 7414
1: 43495
2: 117154
3: 175476
4: 212017
Right 1054420353 9:64922813-64922835 TGTAATCCCAGCACCTTGGGAGG 0: 2883
1: 295004
2: 321239
3: 302032
4: 309860
1054420349_1054420359 22 Left 1054420349 9:64922792-64922814 CCAGGCATGGTGGCTCACGCCTG 0: 7414
1: 43495
2: 117154
3: 175476
4: 212017
Right 1054420359 9:64922837-64922859 TGAGATGGGTAAATCATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054420349 Original CRISPR CAGGCGTGAGCCACCATGCC TGG (reversed) Intergenic
Too many off-targets to display for this crispr