ID: 1054420352

View in Genome Browser
Species Human (GRCh38)
Location 9:64922811-64922833
Sequence TCCCAAGGTGCTGGGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1216548
Summary {0: 2812, 1: 291411, 2: 316717, 3: 298341, 4: 307267}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054420352_1054420359 3 Left 1054420352 9:64922811-64922833 CCTGTAATCCCAGCACCTTGGGA 0: 2812
1: 291411
2: 316717
3: 298341
4: 307267
Right 1054420359 9:64922837-64922859 TGAGATGGGTAAATCATCTGAGG No data
1054420352_1054420361 8 Left 1054420352 9:64922811-64922833 CCTGTAATCCCAGCACCTTGGGA 0: 2812
1: 291411
2: 316717
3: 298341
4: 307267
Right 1054420361 9:64922842-64922864 TGGGTAAATCATCTGAGGTCGGG No data
1054420352_1054420362 26 Left 1054420352 9:64922811-64922833 CCTGTAATCCCAGCACCTTGGGA 0: 2812
1: 291411
2: 316717
3: 298341
4: 307267
Right 1054420362 9:64922860-64922882 TCGGGAGTTCAAGACCAGCCTGG 0: 1173
1: 53932
2: 125695
3: 173970
4: 194616
1054420352_1054420360 7 Left 1054420352 9:64922811-64922833 CCTGTAATCCCAGCACCTTGGGA 0: 2812
1: 291411
2: 316717
3: 298341
4: 307267
Right 1054420360 9:64922841-64922863 ATGGGTAAATCATCTGAGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054420352 Original CRISPR TCCCAAGGTGCTGGGATTAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr