ID: 1054420354

View in Genome Browser
Species Human (GRCh38)
Location 9:64922819-64922841
Sequence TCTCAGCCTCCCAAGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 925733
Summary {0: 79, 1: 7041, 2: 117363, 3: 345517, 4: 455733}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054420354_1054420360 -1 Left 1054420354 9:64922819-64922841 CCCAGCACCTTGGGAGGCTGAGA 0: 79
1: 7041
2: 117363
3: 345517
4: 455733
Right 1054420360 9:64922841-64922863 ATGGGTAAATCATCTGAGGTCGG No data
1054420354_1054420362 18 Left 1054420354 9:64922819-64922841 CCCAGCACCTTGGGAGGCTGAGA 0: 79
1: 7041
2: 117363
3: 345517
4: 455733
Right 1054420362 9:64922860-64922882 TCGGGAGTTCAAGACCAGCCTGG 0: 1173
1: 53932
2: 125695
3: 173970
4: 194616
1054420354_1054420361 0 Left 1054420354 9:64922819-64922841 CCCAGCACCTTGGGAGGCTGAGA 0: 79
1: 7041
2: 117363
3: 345517
4: 455733
Right 1054420361 9:64922842-64922864 TGGGTAAATCATCTGAGGTCGGG No data
1054420354_1054420359 -5 Left 1054420354 9:64922819-64922841 CCCAGCACCTTGGGAGGCTGAGA 0: 79
1: 7041
2: 117363
3: 345517
4: 455733
Right 1054420359 9:64922837-64922859 TGAGATGGGTAAATCATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054420354 Original CRISPR TCTCAGCCTCCCAAGGTGCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr