ID: 1054420355

View in Genome Browser
Species Human (GRCh38)
Location 9:64922820-64922842
Sequence ATCTCAGCCTCCCAAGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 578177
Summary {0: 41, 1: 2733, 2: 41991, 3: 167483, 4: 365929}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054420355_1054420359 -6 Left 1054420355 9:64922820-64922842 CCAGCACCTTGGGAGGCTGAGAT 0: 41
1: 2733
2: 41991
3: 167483
4: 365929
Right 1054420359 9:64922837-64922859 TGAGATGGGTAAATCATCTGAGG No data
1054420355_1054420362 17 Left 1054420355 9:64922820-64922842 CCAGCACCTTGGGAGGCTGAGAT 0: 41
1: 2733
2: 41991
3: 167483
4: 365929
Right 1054420362 9:64922860-64922882 TCGGGAGTTCAAGACCAGCCTGG 0: 1173
1: 53932
2: 125695
3: 173970
4: 194616
1054420355_1054420360 -2 Left 1054420355 9:64922820-64922842 CCAGCACCTTGGGAGGCTGAGAT 0: 41
1: 2733
2: 41991
3: 167483
4: 365929
Right 1054420360 9:64922841-64922863 ATGGGTAAATCATCTGAGGTCGG No data
1054420355_1054420361 -1 Left 1054420355 9:64922820-64922842 CCAGCACCTTGGGAGGCTGAGAT 0: 41
1: 2733
2: 41991
3: 167483
4: 365929
Right 1054420361 9:64922842-64922864 TGGGTAAATCATCTGAGGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054420355 Original CRISPR ATCTCAGCCTCCCAAGGTGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr