ID: 1054420358

View in Genome Browser
Species Human (GRCh38)
Location 9:64922826-64922848
Sequence TTACCCATCTCAGCCTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054420358_1054420361 -7 Left 1054420358 9:64922826-64922848 CCTTGGGAGGCTGAGATGGGTAA No data
Right 1054420361 9:64922842-64922864 TGGGTAAATCATCTGAGGTCGGG No data
1054420358_1054420362 11 Left 1054420358 9:64922826-64922848 CCTTGGGAGGCTGAGATGGGTAA No data
Right 1054420362 9:64922860-64922882 TCGGGAGTTCAAGACCAGCCTGG 0: 1173
1: 53932
2: 125695
3: 173970
4: 194616
1054420358_1054420360 -8 Left 1054420358 9:64922826-64922848 CCTTGGGAGGCTGAGATGGGTAA No data
Right 1054420360 9:64922841-64922863 ATGGGTAAATCATCTGAGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054420358 Original CRISPR TTACCCATCTCAGCCTCCCA AGG (reversed) Intergenic
No off target data available for this crispr