ID: 1054420360

View in Genome Browser
Species Human (GRCh38)
Location 9:64922841-64922863
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054420349_1054420360 26 Left 1054420349 9:64922792-64922814 CCAGGCATGGTGGCTCACGCCTG 0: 7414
1: 43495
2: 117154
3: 175476
4: 212017
Right 1054420360 9:64922841-64922863 ATGGGTAAATCATCTGAGGTCGG No data
1054420355_1054420360 -2 Left 1054420355 9:64922820-64922842 CCAGCACCTTGGGAGGCTGAGAT 0: 41
1: 2733
2: 41991
3: 167483
4: 365929
Right 1054420360 9:64922841-64922863 ATGGGTAAATCATCTGAGGTCGG No data
1054420354_1054420360 -1 Left 1054420354 9:64922819-64922841 CCCAGCACCTTGGGAGGCTGAGA 0: 79
1: 7041
2: 117363
3: 345517
4: 455733
Right 1054420360 9:64922841-64922863 ATGGGTAAATCATCTGAGGTCGG No data
1054420358_1054420360 -8 Left 1054420358 9:64922826-64922848 CCTTGGGAGGCTGAGATGGGTAA No data
Right 1054420360 9:64922841-64922863 ATGGGTAAATCATCTGAGGTCGG No data
1054420352_1054420360 7 Left 1054420352 9:64922811-64922833 CCTGTAATCCCAGCACCTTGGGA 0: 2812
1: 291411
2: 316717
3: 298341
4: 307267
Right 1054420360 9:64922841-64922863 ATGGGTAAATCATCTGAGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054420360 Original CRISPR ATGGGTAAATCATCTGAGGT CGG Intergenic
No off target data available for this crispr