ID: 1054422209

View in Genome Browser
Species Human (GRCh38)
Location 9:64950530-64950552
Sequence CACAAAGAAGTTTCTGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054422209_1054422210 26 Left 1054422209 9:64950530-64950552 CCATTTTCAGAAACTTCTTTGTG No data
Right 1054422210 9:64950579-64950601 AACCTTTCTTTTGATAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054422209 Original CRISPR CACAAAGAAGTTTCTGAAAA TGG (reversed) Intergenic
No off target data available for this crispr