ID: 1054439515

View in Genome Browser
Species Human (GRCh38)
Location 9:65247868-65247890
Sequence AGGAAGGGAGGACTAGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054439515_1054439521 -5 Left 1054439515 9:65247868-65247890 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 1054439521 9:65247886-65247908 TTCCTGTGTCAACTGCTCAAAGG No data
1054439515_1054439525 23 Left 1054439515 9:65247868-65247890 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 1054439525 9:65247914-65247936 CCCCATGAGGTCATCAGTGCAGG No data
1054439515_1054439523 10 Left 1054439515 9:65247868-65247890 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 1054439523 9:65247901-65247923 CTCAAAGGCAAGTCCCCATGAGG No data
1054439515_1054439528 29 Left 1054439515 9:65247868-65247890 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 1054439528 9:65247920-65247942 GAGGTCATCAGTGCAGGCCATGG No data
1054439515_1054439529 30 Left 1054439515 9:65247868-65247890 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 1054439529 9:65247921-65247943 AGGTCATCAGTGCAGGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054439515 Original CRISPR AGGAAGGGAGGACTAGGGCC TGG (reversed) Intergenic