ID: 1054439516

View in Genome Browser
Species Human (GRCh38)
Location 9:65247873-65247895
Sequence GACACAGGAAGGGAGGACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054439516_1054439525 18 Left 1054439516 9:65247873-65247895 CCCTAGTCCTCCCTTCCTGTGTC No data
Right 1054439525 9:65247914-65247936 CCCCATGAGGTCATCAGTGCAGG No data
1054439516_1054439529 25 Left 1054439516 9:65247873-65247895 CCCTAGTCCTCCCTTCCTGTGTC No data
Right 1054439529 9:65247921-65247943 AGGTCATCAGTGCAGGCCATGGG No data
1054439516_1054439521 -10 Left 1054439516 9:65247873-65247895 CCCTAGTCCTCCCTTCCTGTGTC No data
Right 1054439521 9:65247886-65247908 TTCCTGTGTCAACTGCTCAAAGG No data
1054439516_1054439528 24 Left 1054439516 9:65247873-65247895 CCCTAGTCCTCCCTTCCTGTGTC No data
Right 1054439528 9:65247920-65247942 GAGGTCATCAGTGCAGGCCATGG No data
1054439516_1054439523 5 Left 1054439516 9:65247873-65247895 CCCTAGTCCTCCCTTCCTGTGTC No data
Right 1054439523 9:65247901-65247923 CTCAAAGGCAAGTCCCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054439516 Original CRISPR GACACAGGAAGGGAGGACTA GGG (reversed) Intergenic