ID: 1054439517

View in Genome Browser
Species Human (GRCh38)
Location 9:65247874-65247896
Sequence TGACACAGGAAGGGAGGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054439517_1054439523 4 Left 1054439517 9:65247874-65247896 CCTAGTCCTCCCTTCCTGTGTCA No data
Right 1054439523 9:65247901-65247923 CTCAAAGGCAAGTCCCCATGAGG No data
1054439517_1054439528 23 Left 1054439517 9:65247874-65247896 CCTAGTCCTCCCTTCCTGTGTCA No data
Right 1054439528 9:65247920-65247942 GAGGTCATCAGTGCAGGCCATGG No data
1054439517_1054439525 17 Left 1054439517 9:65247874-65247896 CCTAGTCCTCCCTTCCTGTGTCA No data
Right 1054439525 9:65247914-65247936 CCCCATGAGGTCATCAGTGCAGG No data
1054439517_1054439529 24 Left 1054439517 9:65247874-65247896 CCTAGTCCTCCCTTCCTGTGTCA No data
Right 1054439529 9:65247921-65247943 AGGTCATCAGTGCAGGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054439517 Original CRISPR TGACACAGGAAGGGAGGACT AGG (reversed) Intergenic