ID: 1054439518

View in Genome Browser
Species Human (GRCh38)
Location 9:65247880-65247902
Sequence AGCAGTTGACACAGGAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054439518_1054439525 11 Left 1054439518 9:65247880-65247902 CCTCCCTTCCTGTGTCAACTGCT No data
Right 1054439525 9:65247914-65247936 CCCCATGAGGTCATCAGTGCAGG No data
1054439518_1054439531 30 Left 1054439518 9:65247880-65247902 CCTCCCTTCCTGTGTCAACTGCT No data
Right 1054439531 9:65247933-65247955 CAGGCCATGGGAGAGAAGGCAGG No data
1054439518_1054439529 18 Left 1054439518 9:65247880-65247902 CCTCCCTTCCTGTGTCAACTGCT No data
Right 1054439529 9:65247921-65247943 AGGTCATCAGTGCAGGCCATGGG No data
1054439518_1054439523 -2 Left 1054439518 9:65247880-65247902 CCTCCCTTCCTGTGTCAACTGCT No data
Right 1054439523 9:65247901-65247923 CTCAAAGGCAAGTCCCCATGAGG No data
1054439518_1054439528 17 Left 1054439518 9:65247880-65247902 CCTCCCTTCCTGTGTCAACTGCT No data
Right 1054439528 9:65247920-65247942 GAGGTCATCAGTGCAGGCCATGG No data
1054439518_1054439530 26 Left 1054439518 9:65247880-65247902 CCTCCCTTCCTGTGTCAACTGCT No data
Right 1054439530 9:65247929-65247951 AGTGCAGGCCATGGGAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054439518 Original CRISPR AGCAGTTGACACAGGAAGGG AGG (reversed) Intergenic