ID: 1054439520

View in Genome Browser
Species Human (GRCh38)
Location 9:65247884-65247906
Sequence TTTGAGCAGTTGACACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054439520_1054439534 30 Left 1054439520 9:65247884-65247906 CCTTCCTGTGTCAACTGCTCAAA No data
Right 1054439534 9:65247937-65247959 CCATGGGAGAGAAGGCAGGGTGG No data
1054439520_1054439532 27 Left 1054439520 9:65247884-65247906 CCTTCCTGTGTCAACTGCTCAAA No data
Right 1054439532 9:65247934-65247956 AGGCCATGGGAGAGAAGGCAGGG No data
1054439520_1054439525 7 Left 1054439520 9:65247884-65247906 CCTTCCTGTGTCAACTGCTCAAA No data
Right 1054439525 9:65247914-65247936 CCCCATGAGGTCATCAGTGCAGG No data
1054439520_1054439531 26 Left 1054439520 9:65247884-65247906 CCTTCCTGTGTCAACTGCTCAAA No data
Right 1054439531 9:65247933-65247955 CAGGCCATGGGAGAGAAGGCAGG No data
1054439520_1054439523 -6 Left 1054439520 9:65247884-65247906 CCTTCCTGTGTCAACTGCTCAAA No data
Right 1054439523 9:65247901-65247923 CTCAAAGGCAAGTCCCCATGAGG No data
1054439520_1054439528 13 Left 1054439520 9:65247884-65247906 CCTTCCTGTGTCAACTGCTCAAA No data
Right 1054439528 9:65247920-65247942 GAGGTCATCAGTGCAGGCCATGG No data
1054439520_1054439529 14 Left 1054439520 9:65247884-65247906 CCTTCCTGTGTCAACTGCTCAAA No data
Right 1054439529 9:65247921-65247943 AGGTCATCAGTGCAGGCCATGGG No data
1054439520_1054439530 22 Left 1054439520 9:65247884-65247906 CCTTCCTGTGTCAACTGCTCAAA No data
Right 1054439530 9:65247929-65247951 AGTGCAGGCCATGGGAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054439520 Original CRISPR TTTGAGCAGTTGACACAGGA AGG (reversed) Intergenic