ID: 1054439525

View in Genome Browser
Species Human (GRCh38)
Location 9:65247914-65247936
Sequence CCCCATGAGGTCATCAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054439518_1054439525 11 Left 1054439518 9:65247880-65247902 CCTCCCTTCCTGTGTCAACTGCT No data
Right 1054439525 9:65247914-65247936 CCCCATGAGGTCATCAGTGCAGG No data
1054439522_1054439525 3 Left 1054439522 9:65247888-65247910 CCTGTGTCAACTGCTCAAAGGCA No data
Right 1054439525 9:65247914-65247936 CCCCATGAGGTCATCAGTGCAGG No data
1054439517_1054439525 17 Left 1054439517 9:65247874-65247896 CCTAGTCCTCCCTTCCTGTGTCA No data
Right 1054439525 9:65247914-65247936 CCCCATGAGGTCATCAGTGCAGG No data
1054439520_1054439525 7 Left 1054439520 9:65247884-65247906 CCTTCCTGTGTCAACTGCTCAAA No data
Right 1054439525 9:65247914-65247936 CCCCATGAGGTCATCAGTGCAGG No data
1054439515_1054439525 23 Left 1054439515 9:65247868-65247890 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 1054439525 9:65247914-65247936 CCCCATGAGGTCATCAGTGCAGG No data
1054439516_1054439525 18 Left 1054439516 9:65247873-65247895 CCCTAGTCCTCCCTTCCTGTGTC No data
Right 1054439525 9:65247914-65247936 CCCCATGAGGTCATCAGTGCAGG No data
1054439519_1054439525 8 Left 1054439519 9:65247883-65247905 CCCTTCCTGTGTCAACTGCTCAA No data
Right 1054439525 9:65247914-65247936 CCCCATGAGGTCATCAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054439525 Original CRISPR CCCCATGAGGTCATCAGTGC AGG Intergenic