ID: 1054439566

View in Genome Browser
Species Human (GRCh38)
Location 9:65248230-65248252
Sequence AGTTAACTGGAGAAGATGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054439561_1054439566 24 Left 1054439561 9:65248183-65248205 CCACAAAAGCCCAGTATAGGACA No data
Right 1054439566 9:65248230-65248252 AGTTAACTGGAGAAGATGACCGG No data
1054439562_1054439566 15 Left 1054439562 9:65248192-65248214 CCCAGTATAGGACAAGAGCTGTC No data
Right 1054439566 9:65248230-65248252 AGTTAACTGGAGAAGATGACCGG No data
1054439563_1054439566 14 Left 1054439563 9:65248193-65248215 CCAGTATAGGACAAGAGCTGTCT No data
Right 1054439566 9:65248230-65248252 AGTTAACTGGAGAAGATGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054439566 Original CRISPR AGTTAACTGGAGAAGATGAC CGG Intergenic
No off target data available for this crispr