ID: 1054439954

View in Genome Browser
Species Human (GRCh38)
Location 9:65251668-65251690
Sequence ATGGGTCTCTTTAAGATCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054439951_1054439954 -8 Left 1054439951 9:65251653-65251675 CCATTATCCAGAGCTATGGGTCT No data
Right 1054439954 9:65251668-65251690 ATGGGTCTCTTTAAGATCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054439954 Original CRISPR ATGGGTCTCTTTAAGATCTA GGG Intergenic
No off target data available for this crispr