ID: 1054449275

View in Genome Browser
Species Human (GRCh38)
Location 9:65394123-65394145
Sequence TCTCCTAGCTGGTTTCCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054449271_1054449275 -4 Left 1054449271 9:65394104-65394126 CCCTCCATAAGTACACAACTCTC No data
Right 1054449275 9:65394123-65394145 TCTCCTAGCTGGTTTCCTAGAGG No data
1054449269_1054449275 12 Left 1054449269 9:65394088-65394110 CCTTTTGTAACTCCATCCCTCCA No data
Right 1054449275 9:65394123-65394145 TCTCCTAGCTGGTTTCCTAGAGG No data
1054449270_1054449275 0 Left 1054449270 9:65394100-65394122 CCATCCCTCCATAAGTACACAAC No data
Right 1054449275 9:65394123-65394145 TCTCCTAGCTGGTTTCCTAGAGG No data
1054449273_1054449275 -8 Left 1054449273 9:65394108-65394130 CCATAAGTACACAACTCTCCTAG No data
Right 1054449275 9:65394123-65394145 TCTCCTAGCTGGTTTCCTAGAGG No data
1054449266_1054449275 29 Left 1054449266 9:65394071-65394093 CCCTGAGCTCTATTTACCCTTTT No data
Right 1054449275 9:65394123-65394145 TCTCCTAGCTGGTTTCCTAGAGG No data
1054449272_1054449275 -5 Left 1054449272 9:65394105-65394127 CCTCCATAAGTACACAACTCTCC No data
Right 1054449275 9:65394123-65394145 TCTCCTAGCTGGTTTCCTAGAGG No data
1054449268_1054449275 13 Left 1054449268 9:65394087-65394109 CCCTTTTGTAACTCCATCCCTCC No data
Right 1054449275 9:65394123-65394145 TCTCCTAGCTGGTTTCCTAGAGG No data
1054449267_1054449275 28 Left 1054449267 9:65394072-65394094 CCTGAGCTCTATTTACCCTTTTG No data
Right 1054449275 9:65394123-65394145 TCTCCTAGCTGGTTTCCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054449275 Original CRISPR TCTCCTAGCTGGTTTCCTAG AGG Intergenic
No off target data available for this crispr