ID: 1054451830

View in Genome Browser
Species Human (GRCh38)
Location 9:65407417-65407439
Sequence CCAAGGACACTTGTGGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054451830_1054451839 -3 Left 1054451830 9:65407417-65407439 CCCTCAACCACAAGTGTCCTTGG No data
Right 1054451839 9:65407437-65407459 TGGAGGACAGGAAAGGAGCTGGG No data
1054451830_1054451843 19 Left 1054451830 9:65407417-65407439 CCCTCAACCACAAGTGTCCTTGG No data
Right 1054451843 9:65407459-65407481 GAGGCAGGACACTTCGGCTTTGG No data
1054451830_1054451844 23 Left 1054451830 9:65407417-65407439 CCCTCAACCACAAGTGTCCTTGG No data
Right 1054451844 9:65407463-65407485 CAGGACACTTCGGCTTTGGCAGG No data
1054451830_1054451841 4 Left 1054451830 9:65407417-65407439 CCCTCAACCACAAGTGTCCTTGG No data
Right 1054451841 9:65407444-65407466 CAGGAAAGGAGCTGGGAGGCAGG No data
1054451830_1054451845 24 Left 1054451830 9:65407417-65407439 CCCTCAACCACAAGTGTCCTTGG No data
Right 1054451845 9:65407464-65407486 AGGACACTTCGGCTTTGGCAGGG No data
1054451830_1054451840 0 Left 1054451830 9:65407417-65407439 CCCTCAACCACAAGTGTCCTTGG No data
Right 1054451840 9:65407440-65407462 AGGACAGGAAAGGAGCTGGGAGG No data
1054451830_1054451842 13 Left 1054451830 9:65407417-65407439 CCCTCAACCACAAGTGTCCTTGG No data
Right 1054451842 9:65407453-65407475 AGCTGGGAGGCAGGACACTTCGG No data
1054451830_1054451836 -10 Left 1054451830 9:65407417-65407439 CCCTCAACCACAAGTGTCCTTGG No data
Right 1054451836 9:65407430-65407452 GTGTCCTTGGAGGACAGGAAAGG No data
1054451830_1054451838 -4 Left 1054451830 9:65407417-65407439 CCCTCAACCACAAGTGTCCTTGG No data
Right 1054451838 9:65407436-65407458 TTGGAGGACAGGAAAGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054451830 Original CRISPR CCAAGGACACTTGTGGTTGA GGG (reversed) Intergenic
No off target data available for this crispr