ID: 1054452307

View in Genome Browser
Species Human (GRCh38)
Location 9:65409785-65409807
Sequence CTGGGTCACAGGCATCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054452307_1054452316 7 Left 1054452307 9:65409785-65409807 CCCACAGGATGCCTGTGACCCAG No data
Right 1054452316 9:65409815-65409837 TTAACATGGCGCCGCCCTCCAGG No data
1054452307_1054452322 30 Left 1054452307 9:65409785-65409807 CCCACAGGATGCCTGTGACCCAG No data
Right 1054452322 9:65409838-65409860 TCCTCAGCTGAGGCCCCAACTGG No data
1054452307_1054452318 20 Left 1054452307 9:65409785-65409807 CCCACAGGATGCCTGTGACCCAG No data
Right 1054452318 9:65409828-65409850 GCCCTCCAGGTCCTCAGCTGAGG No data
1054452307_1054452313 -7 Left 1054452307 9:65409785-65409807 CCCACAGGATGCCTGTGACCCAG No data
Right 1054452313 9:65409801-65409823 GACCCAGGCTTGGGTTAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054452307 Original CRISPR CTGGGTCACAGGCATCCTGT GGG (reversed) Intergenic