ID: 1054452532

View in Genome Browser
Species Human (GRCh38)
Location 9:65410921-65410943
Sequence CTAGGTGACCTGAGGGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054452532_1054452542 7 Left 1054452532 9:65410921-65410943 CCTTCAGCCCTCAGGTCACCTAG No data
Right 1054452542 9:65410951-65410973 GCTCGGTTCTGGGAGGCTCTGGG No data
1054452532_1054452544 16 Left 1054452532 9:65410921-65410943 CCTTCAGCCCTCAGGTCACCTAG No data
Right 1054452544 9:65410960-65410982 TGGGAGGCTCTGGGCAAGATGGG No data
1054452532_1054452536 -10 Left 1054452532 9:65410921-65410943 CCTTCAGCCCTCAGGTCACCTAG No data
Right 1054452536 9:65410934-65410956 GGTCACCTAGAGTACAGGCTCGG No data
1054452532_1054452543 15 Left 1054452532 9:65410921-65410943 CCTTCAGCCCTCAGGTCACCTAG No data
Right 1054452543 9:65410959-65410981 CTGGGAGGCTCTGGGCAAGATGG No data
1054452532_1054452541 6 Left 1054452532 9:65410921-65410943 CCTTCAGCCCTCAGGTCACCTAG No data
Right 1054452541 9:65410950-65410972 GGCTCGGTTCTGGGAGGCTCTGG No data
1054452532_1054452539 -3 Left 1054452532 9:65410921-65410943 CCTTCAGCCCTCAGGTCACCTAG No data
Right 1054452539 9:65410941-65410963 TAGAGTACAGGCTCGGTTCTGGG No data
1054452532_1054452540 0 Left 1054452532 9:65410921-65410943 CCTTCAGCCCTCAGGTCACCTAG No data
Right 1054452540 9:65410944-65410966 AGTACAGGCTCGGTTCTGGGAGG No data
1054452532_1054452538 -4 Left 1054452532 9:65410921-65410943 CCTTCAGCCCTCAGGTCACCTAG No data
Right 1054452538 9:65410940-65410962 CTAGAGTACAGGCTCGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054452532 Original CRISPR CTAGGTGACCTGAGGGCTGA AGG (reversed) Intergenic
No off target data available for this crispr