ID: 1054454897

View in Genome Browser
Species Human (GRCh38)
Location 9:65424793-65424815
Sequence ATAAATAAGCAGAAGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054454888_1054454897 25 Left 1054454888 9:65424745-65424767 CCACAGTTATGCAATCCTCACAG No data
Right 1054454897 9:65424793-65424815 ATAAATAAGCAGAAGCAGAGAGG No data
1054454892_1054454897 -1 Left 1054454892 9:65424771-65424793 CCCCACTAGGCCCATTCTGCAGA No data
Right 1054454897 9:65424793-65424815 ATAAATAAGCAGAAGCAGAGAGG No data
1054454894_1054454897 -3 Left 1054454894 9:65424773-65424795 CCACTAGGCCCATTCTGCAGATA No data
Right 1054454897 9:65424793-65424815 ATAAATAAGCAGAAGCAGAGAGG No data
1054454893_1054454897 -2 Left 1054454893 9:65424772-65424794 CCCACTAGGCCCATTCTGCAGAT No data
Right 1054454897 9:65424793-65424815 ATAAATAAGCAGAAGCAGAGAGG No data
1054454890_1054454897 10 Left 1054454890 9:65424760-65424782 CCTCACAGCTCCCCCACTAGGCC No data
Right 1054454897 9:65424793-65424815 ATAAATAAGCAGAAGCAGAGAGG No data
1054454891_1054454897 0 Left 1054454891 9:65424770-65424792 CCCCCACTAGGCCCATTCTGCAG No data
Right 1054454897 9:65424793-65424815 ATAAATAAGCAGAAGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054454897 Original CRISPR ATAAATAAGCAGAAGCAGAG AGG Intergenic
No off target data available for this crispr