ID: 1054457472

View in Genome Browser
Species Human (GRCh38)
Location 9:65441821-65441843
Sequence GCTTGGAGATTTTGCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054457472_1054457475 -2 Left 1054457472 9:65441821-65441843 CCAGGCTGGCAAAATCTCCAAGC No data
Right 1054457475 9:65441842-65441864 GCCGGAATAATATCCAGTGCTGG No data
1054457472_1054457477 3 Left 1054457472 9:65441821-65441843 CCAGGCTGGCAAAATCTCCAAGC No data
Right 1054457477 9:65441847-65441869 AATAATATCCAGTGCTGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054457472 Original CRISPR GCTTGGAGATTTTGCCAGCC TGG (reversed) Intergenic
No off target data available for this crispr