ID: 1054462292

View in Genome Browser
Species Human (GRCh38)
Location 9:65471930-65471952
Sequence CCTCACCAGAAGAAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054462292_1054462299 -8 Left 1054462292 9:65471930-65471952 CCCTCCCCCTTCTTCTGGTGAGG No data
Right 1054462299 9:65471945-65471967 TGGTGAGGCCAGAAGTACCCAGG No data
1054462292_1054462300 -4 Left 1054462292 9:65471930-65471952 CCCTCCCCCTTCTTCTGGTGAGG No data
Right 1054462300 9:65471949-65471971 GAGGCCAGAAGTACCCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054462292 Original CRISPR CCTCACCAGAAGAAGGGGGA GGG (reversed) Intergenic
No off target data available for this crispr