ID: 1054463986

View in Genome Browser
Species Human (GRCh38)
Location 9:65481724-65481746
Sequence TCAAGTGGCCGCCTTCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054463986_1054463993 20 Left 1054463986 9:65481724-65481746 CCTCTGTGAAGGCGGCCACTTGA No data
Right 1054463993 9:65481767-65481789 TGTCACACCCGGCAGTGCACAGG No data
1054463986_1054463991 9 Left 1054463986 9:65481724-65481746 CCTCTGTGAAGGCGGCCACTTGA No data
Right 1054463991 9:65481756-65481778 CTAGGAGCCTCTGTCACACCCGG No data
1054463986_1054463989 -9 Left 1054463986 9:65481724-65481746 CCTCTGTGAAGGCGGCCACTTGA No data
Right 1054463989 9:65481738-65481760 GCCACTTGAGGCAGGATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054463986 Original CRISPR TCAAGTGGCCGCCTTCACAG AGG (reversed) Intergenic
No off target data available for this crispr