ID: 1054464543

View in Genome Browser
Species Human (GRCh38)
Location 9:65485720-65485742
Sequence AAACCCATGCTGCTTCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054464540_1054464543 -4 Left 1054464540 9:65485701-65485723 CCGCCTACCATGTGAGTGGAAAC No data
Right 1054464543 9:65485720-65485742 AAACCCATGCTGCTTCTGCCTGG No data
1054464538_1054464543 14 Left 1054464538 9:65485683-65485705 CCAGACGAAATCGCACAGCCGCC No data
Right 1054464543 9:65485720-65485742 AAACCCATGCTGCTTCTGCCTGG No data
1054464537_1054464543 23 Left 1054464537 9:65485674-65485696 CCGGGGACTCCAGACGAAATCGC No data
Right 1054464543 9:65485720-65485742 AAACCCATGCTGCTTCTGCCTGG No data
1054464541_1054464543 -7 Left 1054464541 9:65485704-65485726 CCTACCATGTGAGTGGAAACCCA No data
Right 1054464543 9:65485720-65485742 AAACCCATGCTGCTTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054464543 Original CRISPR AAACCCATGCTGCTTCTGCC TGG Intergenic
No off target data available for this crispr