ID: 1054476119

View in Genome Browser
Species Human (GRCh38)
Location 9:65574458-65574480
Sequence GACCCAGGCATTATTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054476119_1054476128 20 Left 1054476119 9:65574458-65574480 CCTGGGGAAATAATGCCTGGGTC No data
Right 1054476128 9:65574501-65574523 CCCTCTGCTGAGGGACAGTTTGG No data
1054476119_1054476124 10 Left 1054476119 9:65574458-65574480 CCTGGGGAAATAATGCCTGGGTC No data
Right 1054476124 9:65574491-65574513 AGATCCAGGTCCCTCTGCTGAGG No data
1054476119_1054476125 11 Left 1054476119 9:65574458-65574480 CCTGGGGAAATAATGCCTGGGTC No data
Right 1054476125 9:65574492-65574514 GATCCAGGTCCCTCTGCTGAGGG No data
1054476119_1054476130 23 Left 1054476119 9:65574458-65574480 CCTGGGGAAATAATGCCTGGGTC No data
Right 1054476130 9:65574504-65574526 TCTGCTGAGGGACAGTTTGGAGG No data
1054476119_1054476123 -4 Left 1054476119 9:65574458-65574480 CCTGGGGAAATAATGCCTGGGTC No data
Right 1054476123 9:65574477-65574499 GGTCAAGTTAGGGAAGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054476119 Original CRISPR GACCCAGGCATTATTTCCCC AGG (reversed) Intergenic
No off target data available for this crispr