ID: 1054476123

View in Genome Browser
Species Human (GRCh38)
Location 9:65574477-65574499
Sequence GGTCAAGTTAGGGAAGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054476111_1054476123 24 Left 1054476111 9:65574430-65574452 CCCTGCAATGGGTGGGGAAGGGG No data
Right 1054476123 9:65574477-65574499 GGTCAAGTTAGGGAAGATCCAGG No data
1054476113_1054476123 23 Left 1054476113 9:65574431-65574453 CCTGCAATGGGTGGGGAAGGGGA No data
Right 1054476123 9:65574477-65574499 GGTCAAGTTAGGGAAGATCCAGG No data
1054476119_1054476123 -4 Left 1054476119 9:65574458-65574480 CCTGGGGAAATAATGCCTGGGTC No data
Right 1054476123 9:65574477-65574499 GGTCAAGTTAGGGAAGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054476123 Original CRISPR GGTCAAGTTAGGGAAGATCC AGG Intergenic
No off target data available for this crispr