ID: 1054476125 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:65574492-65574514 |
Sequence | GATCCAGGTCCCTCTGCTGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1054476122_1054476125 | -4 | Left | 1054476122 | 9:65574473-65574495 | CCTGGGTCAAGTTAGGGAAGATC | No data | ||
Right | 1054476125 | 9:65574492-65574514 | GATCCAGGTCCCTCTGCTGAGGG | No data | ||||
1054476119_1054476125 | 11 | Left | 1054476119 | 9:65574458-65574480 | CCTGGGGAAATAATGCCTGGGTC | No data | ||
Right | 1054476125 | 9:65574492-65574514 | GATCCAGGTCCCTCTGCTGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1054476125 | Original CRISPR | GATCCAGGTCCCTCTGCTGA GGG | Intergenic | ||