ID: 1054476125

View in Genome Browser
Species Human (GRCh38)
Location 9:65574492-65574514
Sequence GATCCAGGTCCCTCTGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054476119_1054476125 11 Left 1054476119 9:65574458-65574480 CCTGGGGAAATAATGCCTGGGTC No data
Right 1054476125 9:65574492-65574514 GATCCAGGTCCCTCTGCTGAGGG No data
1054476122_1054476125 -4 Left 1054476122 9:65574473-65574495 CCTGGGTCAAGTTAGGGAAGATC No data
Right 1054476125 9:65574492-65574514 GATCCAGGTCCCTCTGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054476125 Original CRISPR GATCCAGGTCCCTCTGCTGA GGG Intergenic
No off target data available for this crispr