ID: 1054476128

View in Genome Browser
Species Human (GRCh38)
Location 9:65574501-65574523
Sequence CCCTCTGCTGAGGGACAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054476119_1054476128 20 Left 1054476119 9:65574458-65574480 CCTGGGGAAATAATGCCTGGGTC No data
Right 1054476128 9:65574501-65574523 CCCTCTGCTGAGGGACAGTTTGG No data
1054476122_1054476128 5 Left 1054476122 9:65574473-65574495 CCTGGGTCAAGTTAGGGAAGATC No data
Right 1054476128 9:65574501-65574523 CCCTCTGCTGAGGGACAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054476128 Original CRISPR CCCTCTGCTGAGGGACAGTT TGG Intergenic
No off target data available for this crispr