ID: 1054476233

View in Genome Browser
Species Human (GRCh38)
Location 9:65575327-65575349
Sequence GAACCCAAGTTGGGACAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054476233_1054476243 18 Left 1054476233 9:65575327-65575349 CCTGCCTGTCCCAACTTGGGTTC No data
Right 1054476243 9:65575368-65575390 CAGGCTCATAGTCTTTCACCTGG No data
1054476233_1054476244 19 Left 1054476233 9:65575327-65575349 CCTGCCTGTCCCAACTTGGGTTC No data
Right 1054476244 9:65575369-65575391 AGGCTCATAGTCTTTCACCTGGG No data
1054476233_1054476237 -1 Left 1054476233 9:65575327-65575349 CCTGCCTGTCCCAACTTGGGTTC No data
Right 1054476237 9:65575349-65575371 CTACCCTGATCCCTTCCGACAGG No data
1054476233_1054476245 29 Left 1054476233 9:65575327-65575349 CCTGCCTGTCCCAACTTGGGTTC No data
Right 1054476245 9:65575379-65575401 TCTTTCACCTGGGCTTTCTCTGG No data
1054476233_1054476246 30 Left 1054476233 9:65575327-65575349 CCTGCCTGTCCCAACTTGGGTTC No data
Right 1054476246 9:65575380-65575402 CTTTCACCTGGGCTTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054476233 Original CRISPR GAACCCAAGTTGGGACAGGC AGG (reversed) Intergenic
No off target data available for this crispr