ID: 1054476237

View in Genome Browser
Species Human (GRCh38)
Location 9:65575349-65575371
Sequence CTACCCTGATCCCTTCCGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054476226_1054476237 22 Left 1054476226 9:65575304-65575326 CCCTAAAGACTAGGACTGCCTCC No data
Right 1054476237 9:65575349-65575371 CTACCCTGATCCCTTCCGACAGG No data
1054476231_1054476237 1 Left 1054476231 9:65575325-65575347 CCCCTGCCTGTCCCAACTTGGGT No data
Right 1054476237 9:65575349-65575371 CTACCCTGATCCCTTCCGACAGG No data
1054476235_1054476237 -10 Left 1054476235 9:65575336-65575358 CCCAACTTGGGTTCTACCCTGAT No data
Right 1054476237 9:65575349-65575371 CTACCCTGATCCCTTCCGACAGG No data
1054476225_1054476237 23 Left 1054476225 9:65575303-65575325 CCCCTAAAGACTAGGACTGCCTC No data
Right 1054476237 9:65575349-65575371 CTACCCTGATCCCTTCCGACAGG No data
1054476227_1054476237 21 Left 1054476227 9:65575305-65575327 CCTAAAGACTAGGACTGCCTCCC No data
Right 1054476237 9:65575349-65575371 CTACCCTGATCCCTTCCGACAGG No data
1054476232_1054476237 0 Left 1054476232 9:65575326-65575348 CCCTGCCTGTCCCAACTTGGGTT No data
Right 1054476237 9:65575349-65575371 CTACCCTGATCCCTTCCGACAGG No data
1054476223_1054476237 25 Left 1054476223 9:65575301-65575323 CCCCCCTAAAGACTAGGACTGCC No data
Right 1054476237 9:65575349-65575371 CTACCCTGATCCCTTCCGACAGG No data
1054476234_1054476237 -5 Left 1054476234 9:65575331-65575353 CCTGTCCCAACTTGGGTTCTACC No data
Right 1054476237 9:65575349-65575371 CTACCCTGATCCCTTCCGACAGG No data
1054476228_1054476237 4 Left 1054476228 9:65575322-65575344 CCTCCCCTGCCTGTCCCAACTTG No data
Right 1054476237 9:65575349-65575371 CTACCCTGATCCCTTCCGACAGG No data
1054476233_1054476237 -1 Left 1054476233 9:65575327-65575349 CCTGCCTGTCCCAACTTGGGTTC No data
Right 1054476237 9:65575349-65575371 CTACCCTGATCCCTTCCGACAGG No data
1054476224_1054476237 24 Left 1054476224 9:65575302-65575324 CCCCCTAAAGACTAGGACTGCCT No data
Right 1054476237 9:65575349-65575371 CTACCCTGATCCCTTCCGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054476237 Original CRISPR CTACCCTGATCCCTTCCGAC AGG Intergenic
No off target data available for this crispr