ID: 1054476243

View in Genome Browser
Species Human (GRCh38)
Location 9:65575368-65575390
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054476236_1054476243 8 Left 1054476236 9:65575337-65575359 CCAACTTGGGTTCTACCCTGATC No data
Right 1054476243 9:65575368-65575390 CAGGCTCATAGTCTTTCACCTGG No data
1054476233_1054476243 18 Left 1054476233 9:65575327-65575349 CCTGCCTGTCCCAACTTGGGTTC No data
Right 1054476243 9:65575368-65575390 CAGGCTCATAGTCTTTCACCTGG No data
1054476232_1054476243 19 Left 1054476232 9:65575326-65575348 CCCTGCCTGTCCCAACTTGGGTT No data
Right 1054476243 9:65575368-65575390 CAGGCTCATAGTCTTTCACCTGG No data
1054476234_1054476243 14 Left 1054476234 9:65575331-65575353 CCTGTCCCAACTTGGGTTCTACC No data
Right 1054476243 9:65575368-65575390 CAGGCTCATAGTCTTTCACCTGG No data
1054476239_1054476243 -8 Left 1054476239 9:65575353-65575375 CCTGATCCCTTCCGACAGGCTCA No data
Right 1054476243 9:65575368-65575390 CAGGCTCATAGTCTTTCACCTGG No data
1054476228_1054476243 23 Left 1054476228 9:65575322-65575344 CCTCCCCTGCCTGTCCCAACTTG No data
Right 1054476243 9:65575368-65575390 CAGGCTCATAGTCTTTCACCTGG No data
1054476231_1054476243 20 Left 1054476231 9:65575325-65575347 CCCCTGCCTGTCCCAACTTGGGT No data
Right 1054476243 9:65575368-65575390 CAGGCTCATAGTCTTTCACCTGG No data
1054476238_1054476243 -7 Left 1054476238 9:65575352-65575374 CCCTGATCCCTTCCGACAGGCTC No data
Right 1054476243 9:65575368-65575390 CAGGCTCATAGTCTTTCACCTGG No data
1054476235_1054476243 9 Left 1054476235 9:65575336-65575358 CCCAACTTGGGTTCTACCCTGAT No data
Right 1054476243 9:65575368-65575390 CAGGCTCATAGTCTTTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054476243 Original CRISPR CAGGCTCATAGTCTTTCACC TGG Intergenic
No off target data available for this crispr