ID: 1054476245

View in Genome Browser
Species Human (GRCh38)
Location 9:65575379-65575401
Sequence TCTTTCACCTGGGCTTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054476235_1054476245 20 Left 1054476235 9:65575336-65575358 CCCAACTTGGGTTCTACCCTGAT No data
Right 1054476245 9:65575379-65575401 TCTTTCACCTGGGCTTTCTCTGG No data
1054476236_1054476245 19 Left 1054476236 9:65575337-65575359 CCAACTTGGGTTCTACCCTGATC No data
Right 1054476245 9:65575379-65575401 TCTTTCACCTGGGCTTTCTCTGG No data
1054476232_1054476245 30 Left 1054476232 9:65575326-65575348 CCCTGCCTGTCCCAACTTGGGTT No data
Right 1054476245 9:65575379-65575401 TCTTTCACCTGGGCTTTCTCTGG No data
1054476238_1054476245 4 Left 1054476238 9:65575352-65575374 CCCTGATCCCTTCCGACAGGCTC No data
Right 1054476245 9:65575379-65575401 TCTTTCACCTGGGCTTTCTCTGG No data
1054476242_1054476245 -8 Left 1054476242 9:65575364-65575386 CCGACAGGCTCATAGTCTTTCAC No data
Right 1054476245 9:65575379-65575401 TCTTTCACCTGGGCTTTCTCTGG No data
1054476233_1054476245 29 Left 1054476233 9:65575327-65575349 CCTGCCTGTCCCAACTTGGGTTC No data
Right 1054476245 9:65575379-65575401 TCTTTCACCTGGGCTTTCTCTGG No data
1054476234_1054476245 25 Left 1054476234 9:65575331-65575353 CCTGTCCCAACTTGGGTTCTACC No data
Right 1054476245 9:65575379-65575401 TCTTTCACCTGGGCTTTCTCTGG No data
1054476239_1054476245 3 Left 1054476239 9:65575353-65575375 CCTGATCCCTTCCGACAGGCTCA No data
Right 1054476245 9:65575379-65575401 TCTTTCACCTGGGCTTTCTCTGG No data
1054476241_1054476245 -4 Left 1054476241 9:65575360-65575382 CCTTCCGACAGGCTCATAGTCTT No data
Right 1054476245 9:65575379-65575401 TCTTTCACCTGGGCTTTCTCTGG No data
1054476240_1054476245 -3 Left 1054476240 9:65575359-65575381 CCCTTCCGACAGGCTCATAGTCT No data
Right 1054476245 9:65575379-65575401 TCTTTCACCTGGGCTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054476245 Original CRISPR TCTTTCACCTGGGCTTTCTC TGG Intergenic
No off target data available for this crispr