ID: 1054477718

View in Genome Browser
Species Human (GRCh38)
Location 9:65585220-65585242
Sequence CTGGCTACACATTAGCAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054477707_1054477718 26 Left 1054477707 9:65585171-65585193 CCCTCCCCCTTATCTCTTGTATT No data
Right 1054477718 9:65585220-65585242 CTGGCTACACATTAGCAACCTGG No data
1054477709_1054477718 22 Left 1054477709 9:65585175-65585197 CCCCCTTATCTCTTGTATTATTT No data
Right 1054477718 9:65585220-65585242 CTGGCTACACATTAGCAACCTGG No data
1054477715_1054477718 -1 Left 1054477715 9:65585198-65585220 CCTAGGGCCTGCATCTCAATCTC No data
Right 1054477718 9:65585220-65585242 CTGGCTACACATTAGCAACCTGG No data
1054477710_1054477718 21 Left 1054477710 9:65585176-65585198 CCCCTTATCTCTTGTATTATTTC No data
Right 1054477718 9:65585220-65585242 CTGGCTACACATTAGCAACCTGG No data
1054477712_1054477718 19 Left 1054477712 9:65585178-65585200 CCTTATCTCTTGTATTATTTCCT No data
Right 1054477718 9:65585220-65585242 CTGGCTACACATTAGCAACCTGG No data
1054477711_1054477718 20 Left 1054477711 9:65585177-65585199 CCCTTATCTCTTGTATTATTTCC No data
Right 1054477718 9:65585220-65585242 CTGGCTACACATTAGCAACCTGG No data
1054477717_1054477718 -8 Left 1054477717 9:65585205-65585227 CCTGCATCTCAATCTCTGGCTAC No data
Right 1054477718 9:65585220-65585242 CTGGCTACACATTAGCAACCTGG No data
1054477708_1054477718 25 Left 1054477708 9:65585172-65585194 CCTCCCCCTTATCTCTTGTATTA No data
Right 1054477718 9:65585220-65585242 CTGGCTACACATTAGCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054477718 Original CRISPR CTGGCTACACATTAGCAACC TGG Intergenic
No off target data available for this crispr