ID: 1054477803

View in Genome Browser
Species Human (GRCh38)
Location 9:65585762-65585784
Sequence TATCCCTCCCTCTCTGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054477800_1054477803 7 Left 1054477800 9:65585732-65585754 CCCTGCTTATCTGCAAGACTGTG No data
Right 1054477803 9:65585762-65585784 TATCCCTCCCTCTCTGGTGCTGG No data
1054477801_1054477803 6 Left 1054477801 9:65585733-65585755 CCTGCTTATCTGCAAGACTGTGT No data
Right 1054477803 9:65585762-65585784 TATCCCTCCCTCTCTGGTGCTGG No data
1054477799_1054477803 20 Left 1054477799 9:65585719-65585741 CCTGGTAAATGGGCCCTGCTTAT No data
Right 1054477803 9:65585762-65585784 TATCCCTCCCTCTCTGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054477803 Original CRISPR TATCCCTCCCTCTCTGGTGC TGG Intergenic
No off target data available for this crispr