ID: 1054479104

View in Genome Browser
Species Human (GRCh38)
Location 9:65594072-65594094
Sequence TCTCCTAGCTGGTTTCCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054479104_1054479113 29 Left 1054479104 9:65594072-65594094 CCTCTAGGAAACCAGCTAGGAGA No data
Right 1054479113 9:65594124-65594146 AAAAGGGTAAATAGAGCTCAGGG No data
1054479104_1054479109 0 Left 1054479104 9:65594072-65594094 CCTCTAGGAAACCAGCTAGGAGA No data
Right 1054479109 9:65594095-65594117 GTTGTGTACTTATGGAGGGATGG No data
1054479104_1054479106 -8 Left 1054479104 9:65594072-65594094 CCTCTAGGAAACCAGCTAGGAGA No data
Right 1054479106 9:65594087-65594109 CTAGGAGAGTTGTGTACTTATGG No data
1054479104_1054479111 13 Left 1054479104 9:65594072-65594094 CCTCTAGGAAACCAGCTAGGAGA No data
Right 1054479111 9:65594108-65594130 GGAGGGATGGAGTTACAAAAGGG No data
1054479104_1054479108 -4 Left 1054479104 9:65594072-65594094 CCTCTAGGAAACCAGCTAGGAGA No data
Right 1054479108 9:65594091-65594113 GAGAGTTGTGTACTTATGGAGGG No data
1054479104_1054479110 12 Left 1054479104 9:65594072-65594094 CCTCTAGGAAACCAGCTAGGAGA No data
Right 1054479110 9:65594107-65594129 TGGAGGGATGGAGTTACAAAAGG No data
1054479104_1054479107 -5 Left 1054479104 9:65594072-65594094 CCTCTAGGAAACCAGCTAGGAGA No data
Right 1054479107 9:65594090-65594112 GGAGAGTTGTGTACTTATGGAGG No data
1054479104_1054479112 28 Left 1054479104 9:65594072-65594094 CCTCTAGGAAACCAGCTAGGAGA No data
Right 1054479112 9:65594123-65594145 CAAAAGGGTAAATAGAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054479104 Original CRISPR TCTCCTAGCTGGTTTCCTAG AGG (reversed) Intergenic
No off target data available for this crispr