ID: 1054484323

View in Genome Browser
Species Human (GRCh38)
Location 9:65705608-65705630
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 6, 1: 1, 2: 3, 3: 12, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054484319_1054484323 -1 Left 1054484319 9:65705586-65705608 CCTGAGTCTTAAAGAATGAATAA 0: 7
1: 0
2: 4
3: 44
4: 465
Right 1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG 0: 6
1: 1
2: 3
3: 12
4: 222
1054484318_1054484323 18 Left 1054484318 9:65705567-65705589 CCGAGAAGGCAGTCATTGACCTG 0: 6
1: 1
2: 1
3: 15
4: 209
Right 1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG 0: 6
1: 1
2: 3
3: 12
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902086546 1:13867268-13867290 AGGTCTTTGCAGATGTAGTCAGG - Intergenic
906004668 1:42458017-42458039 AGGTCATTCCAGGTGGAGTATGG + Intronic
907825912 1:58016741-58016763 AGCTTATTACAGATGGAGAATGG - Intronic
907837400 1:58123355-58123377 AGATGCTTTCAGATGGAGTAAGG - Intronic
907928377 1:58975730-58975752 AGGTTTTAACACATGGATTTTGG + Intergenic
907948924 1:59162048-59162070 AGGTTTTAACATATGGATTTTGG + Intergenic
908947290 1:69514465-69514487 TGGTTTTTAAAGATGGTGTTTGG - Intergenic
908953679 1:69594615-69594637 AAGTCTGTACGGATGGAGTATGG - Intronic
911064596 1:93776938-93776960 GGGTTCTTACAGATGGAATCAGG + Intronic
911554550 1:99327650-99327672 AGGTTTTTAGAGATGATGTTTGG - Intergenic
911658881 1:100477005-100477027 TGCATTTTAAAGATGGAGTAAGG + Intronic
911741428 1:101390160-101390182 ATGTTTGTACACATGGAGGAGGG + Intergenic
916091270 1:161309566-161309588 TGAATTTTACAGATGGAGTCTGG + Intronic
917690409 1:177462585-177462607 TAGGTTTTACAGATGGAGAAAGG + Intergenic
918146127 1:181757732-181757754 AGGTGTTGCCACATGGAGTAGGG - Intronic
919088084 1:192945406-192945428 GCGTTTTCACAGATGTAGTAGGG - Intergenic
921650792 1:217675152-217675174 AGGTTTGTAGAGAAGGAGGATGG + Intronic
921800328 1:219395784-219395806 TGATTTTTACATATGGTGTAAGG + Intergenic
922747556 1:228053313-228053335 TGATTTTTACAGATGGTGTGAGG - Intronic
923165298 1:231355841-231355863 AGTGTTTAACAGATGTAGTAAGG - Intergenic
923225985 1:231939416-231939438 AGTTCATTACAGATGGAGAAAGG - Intronic
923270434 1:232350532-232350554 ACATTTTTACATATGGTGTATGG - Intergenic
924039708 1:239972392-239972414 AGATGTTTATAGATGGAGGAAGG + Intergenic
924689944 1:246337773-246337795 AGGTTTTAACAGAGGGGTTATGG - Intronic
1063489264 10:6448036-6448058 GGATTTTTCCAGGTGGAGTAGGG + Intronic
1063906989 10:10791254-10791276 AGATTTTTATAGATTGAGTGTGG + Intergenic
1064153692 10:12886364-12886386 GGGTTTTTAAAGATGGCATAGGG + Intergenic
1064818866 10:19300684-19300706 TGGTTTTTGAATATGGAGTAAGG - Intronic
1065701703 10:28432129-28432151 AGGTTTTCGGAGATGGGGTATGG - Intergenic
1066668027 10:37805539-37805561 AGGTTTTTACAGAGTGAATGTGG - Intronic
1068294107 10:55045012-55045034 ATGTGTTTACAGAATGAGTATGG - Intronic
1069014647 10:63415308-63415330 AGGTTTTATTAGATGGAGAAGGG - Intronic
1072171074 10:92862339-92862361 AGGTTTTAACATATGAATTATGG - Intronic
1072583574 10:96761655-96761677 AGATTTATACATATGGAGCAGGG - Intergenic
1076712165 10:132343474-132343496 AGCTTTTTAAAGAAGGAGTTTGG + Intronic
1077533579 11:3108373-3108395 AGGTTTCTGCAGGTGGAGTTAGG + Intronic
1078671460 11:13369456-13369478 AGGCTTTAACAGATGCAGCATGG - Intronic
1079217858 11:18530515-18530537 AGGTTAATCCAGATGGAGTTAGG - Exonic
1080302073 11:30795761-30795783 AGGATTATAGAGATGCAGTATGG - Intergenic
1080515932 11:33020101-33020123 AGGTTTTCACAGTAGGACTAGGG + Intronic
1082631355 11:55545915-55545937 AAGATTGTAAAGATGGAGTAAGG - Intergenic
1084789721 11:71466134-71466156 AGGTTTTTAAAAATTGAGAATGG + Intronic
1088572000 11:111231408-111231430 AGGTTTCTAGAGGTGGAGTGAGG - Intergenic
1090299851 11:125626042-125626064 AGGTTTCTAAAGAAGGAGTTCGG + Intronic
1092829561 12:12430507-12430529 AGGTTTTTACTTATGGAGTAGGG + Intronic
1093887943 12:24485032-24485054 AGGTTCGGACAGATGGAGAAAGG + Intergenic
1094290263 12:28840342-28840364 TGGTTTTTATATATGGTGTAAGG - Intergenic
1097038693 12:56141336-56141358 AGGTTGTTACATTTGGAATATGG + Intronic
1097919616 12:65057368-65057390 AGAATTTTAGAGCTGGAGTAAGG + Intronic
1098413287 12:70204295-70204317 AAAATTTTACAGATGGAGGAAGG + Intergenic
1098811719 12:75102975-75102997 AGGTTTTCACAGTAGGAGAAAGG + Intronic
1099222212 12:79928462-79928484 AGGTTTTTAAAAATGGATTTAGG + Intronic
1099518310 12:83626890-83626912 AGGTGTATATAGATGAAGTATGG - Intergenic
1099673473 12:85726202-85726224 TGGTTGTCACAGATGGGGTAAGG - Intergenic
1099782315 12:87212346-87212368 AGCTGGATACAGATGGAGTAGGG - Intergenic
1100506387 12:95224827-95224849 CAGTTTTTCCAGATGGAGGATGG + Intronic
1107068440 13:36243137-36243159 AGGTTTGGGCAGAGGGAGTAGGG - Intronic
1107146673 13:37067783-37067805 AGGTTTTAAGAGCTGGAGTAGGG - Intergenic
1109979493 13:69888273-69888295 AGGTTTTAACATATGGAATTTGG + Intronic
1111047655 13:82835670-82835692 ATTTTTTTAGAGATGGAGTCTGG - Intergenic
1111395697 13:87666509-87666531 AGATTTTTTCAGATGGAGAAAGG + Intergenic
1111465949 13:88611030-88611052 ATGTTTTTGCAGCTGGAGCAGGG - Intergenic
1112243032 13:97701393-97701415 AGGTTTCTTCAGATTGAGTAAGG - Intergenic
1114591503 14:23869191-23869213 AGTTTTTAAGAGATGGGGTAGGG + Intergenic
1115131096 14:30053050-30053072 AGGTTATTTCATATGTAGTAAGG + Intronic
1115594752 14:34898648-34898670 AGGTTGTTAGAGAAGGAGCACGG + Intergenic
1116585482 14:46697723-46697745 AGGTTTTAACAGATGAATTTTGG + Intergenic
1117389229 14:55247356-55247378 TGGTTTTTCCAGATGGGGTTGGG - Intergenic
1117532789 14:56675578-56675600 AGGTTCCTACAGATGGTATATGG - Intronic
1120794251 14:88614785-88614807 AAGTTTTTACAAATGGAGTTGGG + Exonic
1121109255 14:91301377-91301399 AGGTTTTGGCAGGTGGAGTCTGG - Intronic
1122255006 14:100470172-100470194 AGGTTCTTGCAGATGGAACAAGG + Intronic
1124830329 15:33142564-33142586 AGATCTTTACAGATGGGTTATGG - Intronic
1126805342 15:52342611-52342633 AGGTTTTTAAAGAAGGTGTTTGG + Intronic
1126838181 15:52688901-52688923 CTATTTTTACAGATGGAGGAAGG + Intronic
1127899849 15:63333116-63333138 AGAATTTTCCAGATGGAGGAGGG + Intronic
1131302713 15:91213593-91213615 AAATTTTTACAGATGAATTATGG - Intronic
1133319695 16:4905281-4905303 AGGCTTGTTCAGATGGAGCACGG - Intronic
1140028162 16:71311009-71311031 AGGTTTAAAGAGATGGAGGAAGG + Intergenic
1144027715 17:11293145-11293167 AGGTTTTTCCAGTTGCTGTATGG + Intronic
1144311652 17:14019414-14019436 AGAGTTTTACAGATGGAGGGTGG + Intergenic
1145902576 17:28498120-28498142 CGGTTTTTCCAGCTGGAGGAAGG - Intronic
1146015405 17:29229158-29229180 AGGTCTTTGCAGATGAAATAAGG + Intergenic
1146589991 17:34120667-34120689 AGGTTATACTAGATGGAGTAAGG + Intronic
1146834772 17:36101854-36101876 TGATTTTTACAGATGGTGTAAGG + Intergenic
1146849379 17:36209036-36209058 TGATTTTTACAGATGGTGTAAGG + Intronic
1148717427 17:49725774-49725796 ACGTTTTTGCAGATGTATTAAGG + Intronic
1149337551 17:55651956-55651978 AGGTTCTGACAGATTGAGAAAGG + Intergenic
1150376872 17:64688733-64688755 TTGTTTTTAGAGATGGAGTTTGG - Intergenic
1150770503 17:68036692-68036714 AAGATTTCAAAGATGGAGTATGG + Intronic
1154025142 18:10699750-10699772 AGCTTTTGGCAGATGGACTAAGG + Intronic
1156579632 18:38359858-38359880 AGGCTGTGTCAGATGGAGTAAGG - Intergenic
1157375207 18:47157445-47157467 CGGTTCTTACAGATCGAATAAGG + Exonic
1158218565 18:55126411-55126433 AGGTTTTTATAAATGGACTCAGG - Intergenic
1159100504 18:63952814-63952836 ATGTTTTTATAAATGGAGGAAGG - Intronic
1159547800 18:69862226-69862248 ACATTTTTACAGTTGTAGTATGG - Exonic
1160736430 19:664651-664673 TGTTTTTTAGAGATGGAGTCTGG + Intergenic
1162045443 19:7996799-7996821 TGGTTTTTGGAGATGGAGTCTGG - Intronic
1163593099 19:18205147-18205169 AGGGTTTGAAAGCTGGAGTAGGG - Intergenic
1166165016 19:40981315-40981337 AGGTGGTTTCAGATGGAGAAGGG - Intergenic
1167340021 19:48909912-48909934 AGGTCTTTACAGAGGGAATCAGG - Intronic
1168081299 19:54012342-54012364 ACGTATTTACAGAGGGAGAAAGG - Exonic
925121909 2:1425494-1425516 ATGACTTTACAGAAGGAGTACGG - Intronic
925124193 2:1442209-1442231 AGACTAATACAGATGGAGTAGGG + Intronic
925694357 2:6560104-6560126 AGGTTTTTAAATATGGAATGTGG + Intergenic
928083382 2:28329295-28329317 AGTTTTATACAAATGGGGTAGGG - Intronic
928805180 2:35141254-35141276 AGTTTTTTACAGATGATGGAAGG - Intergenic
930793558 2:55361072-55361094 AAGTTTTTTGAGATGGAGTCTGG - Intronic
931656662 2:64515440-64515462 AGGATTTTAAAGATGTAGAAAGG - Intergenic
931981713 2:67700124-67700146 AGGTTTCTACCTATGGAGCAAGG + Intergenic
933401191 2:81797656-81797678 AGGCTTGTACAAATTGAGTATGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
938795392 2:134714729-134714751 AGATTTTTACAGAGAGAGGATGG - Intronic
940778230 2:157906354-157906376 AGGATATTACAAATGGAGGATGG + Intronic
941244649 2:163081162-163081184 AAGTTTTTACAGAGAGAGAATGG - Intergenic
941764236 2:169278950-169278972 AGATTTTTAAAGATGGAGGTTGG - Intronic
942438644 2:176008214-176008236 ATGTTCTTACATATGGAGAAAGG + Intergenic
943686900 2:190827972-190827994 AGGTCTTTACAGATTGTGCAAGG + Intergenic
944644135 2:201761521-201761543 AGGATTTTACAGTTGGCGTGTGG - Exonic
944684272 2:202104510-202104532 TGGTTTTCACAGAAGGAATATGG + Intronic
1172202747 20:33138420-33138442 GGATTCTCACAGATGGAGTAGGG - Intergenic
1173044195 20:39493752-39493774 TGTTTGGTACAGATGGAGTATGG + Intergenic
1174537845 20:51266433-51266455 AGGTATTTACTGAGGGAATAGGG + Intergenic
1174633383 20:51977950-51977972 AGGTCTTTGCAGATGTAATAAGG + Intergenic
1175157639 20:56982682-56982704 AGGTTCTTACTGATGGGGAATGG + Intergenic
1175304026 20:57963787-57963809 AGGATTTTACATATGGCTTAGGG - Intergenic
1177234386 21:18368135-18368157 AGGTTTTTACAGATGCTTAAAGG - Intronic
1179119307 21:38528221-38528243 GGGTTATTGCAGATGTAGTAGGG - Intronic
1179625245 21:42645597-42645619 AGCTTTGTACAGAAGGAGCAAGG + Intergenic
1182441758 22:30368721-30368743 AGCTTTTTGCAGATGCAGGAGGG - Intronic
1183080363 22:35452068-35452090 TGGTTTTTACACATGGATGAGGG - Intergenic
950812915 3:15666814-15666836 AGATTTGAACAGATGGAGAAGGG - Intergenic
952685616 3:36144627-36144649 AGGAATTCACAGTTGGAGTATGG - Intergenic
952754546 3:36855065-36855087 AGGTTTTTACAGCTGAAGTAAGG - Intronic
952825860 3:37524241-37524263 AGGTGTTTCAAGATGGAGTGGGG + Intronic
955004965 3:54959874-54959896 AGGTTTCTTCAGATGAAGTCTGG + Intronic
955031480 3:55225676-55225698 AGGGTTTTAGAGATGAGGTAAGG + Intergenic
955040134 3:55308377-55308399 AGGTTTTCACAAATGAATTAGGG + Intergenic
955231020 3:57098729-57098751 AAGTTTTTGCAGAGGGACTAGGG - Intronic
955680892 3:61500684-61500706 AGATTTTTATATATGGTGTAAGG + Intergenic
956020026 3:64924298-64924320 AGGTGTTTACAGGAGGAGTGAGG + Intergenic
956756342 3:72391517-72391539 TGGGTTTTACAGAAGAAGTATGG - Intronic
958667065 3:97154624-97154646 ATGTTTTTAAAGGTGGAGGAAGG - Intronic
959930578 3:111977805-111977827 AGGTATTTAGAGCTGGAGTCCGG + Intergenic
960201505 3:114842406-114842428 AAGTTTTTAAAGAAGGGGTAAGG - Intronic
961207941 3:125102215-125102237 AGAGTTTTCCAGATGGAGAAGGG + Intronic
961917268 3:130390324-130390346 AGGTTTTTACAGATACAGCCTGG + Intronic
966294243 3:178400329-178400351 AAGTTTTTACTCATGGAGGAAGG - Intergenic
967734109 3:192934035-192934057 AGATATTTACAGAAGGAGTATGG + Intergenic
967736617 3:192959766-192959788 AGACTAATACAGATGGAGTAGGG - Intergenic
969210662 4:5684767-5684789 GGGTCTTTACAGAGGTAGTAAGG + Intronic
970083558 4:12319116-12319138 AGGTTTTTACTCATGAAGAATGG - Intergenic
971103564 4:23497089-23497111 AGGTACTTACAGATGAAGAAGGG + Intergenic
972943323 4:44223505-44223527 AAGTTTTTACTGATTGAATATGG - Intronic
976010580 4:80483108-80483130 AGGTTCTTAAAGGTGGAGGAGGG + Intronic
979835695 4:125364710-125364732 AGGTTTTTTCAGCTGGTGCATGG + Intronic
980353298 4:131711303-131711325 AAATTTTTAAAGATAGAGTAAGG - Intergenic
980784380 4:137533058-137533080 AAGTATTTACAGAGGGAGTGGGG - Intergenic
982097453 4:151935785-151935807 AGGGTTTTGTAGATGGAGAAGGG + Intergenic
984338419 4:178421952-178421974 AGATTTTTCCAAATGGAATAGGG + Intergenic
985928822 5:3039396-3039418 TGGTTTTGATAAATGGAGTATGG + Intergenic
988818202 5:34854985-34855007 AGGGTTGTAAAGAAGGAGTAGGG + Intronic
989342037 5:40387056-40387078 TGATTTTTACAGATGGGGTCAGG + Intergenic
990569062 5:57059638-57059660 AGGTTTTAGCTGAGGGAGTAAGG - Intergenic
990957996 5:61363083-61363105 ATGTTTTTAGAGATGTTGTAGGG + Intronic
995083220 5:108078302-108078324 AGGTTGTTAGAGATGGACAAAGG - Intronic
995099878 5:108287096-108287118 TGATTTTTATAGATGGTGTAAGG - Intronic
995553927 5:113308475-113308497 AGGTTTTTAGAGATGGGGATGGG - Intronic
996819589 5:127611822-127611844 AGGTTATTGCAGATTGAATATGG - Intergenic
997146832 5:131443562-131443584 AGGTTTGTGCAGAAGGAGAAGGG - Intronic
997181814 5:131837036-131837058 TGATTTTTACACATGGTGTAAGG + Intronic
998692238 5:144599411-144599433 TTTTTTTTACAGATGGAGTCTGG + Intergenic
1001728008 5:173924086-173924108 ATGTTTCTACAGATGGAGGAAGG - Intronic
1004285852 6:14320024-14320046 ATCTTTTTACAAATGGAGCAAGG - Intergenic
1006875861 6:37295646-37295668 AGGTTCTTACAGATCAAATAAGG + Intronic
1008702326 6:54116005-54116027 AGGTTTTGAGAGTTGGAGCAGGG + Intronic
1008806213 6:55431771-55431793 AGGTTTTTACTCATGGTGGAAGG - Intergenic
1009405725 6:63310087-63310109 AGTTTTGTACAGATGGAGATAGG - Intronic
1010968307 6:82237264-82237286 AAGGTTTTACAGATGGAAAAGGG + Intronic
1011001765 6:82597712-82597734 AGGTTTTTAAAAATGGAGTAGGG + Intergenic
1011183987 6:84653774-84653796 AGGTTTTAACACATGGATTTTGG + Intergenic
1011691338 6:89872228-89872250 ATGTTTTAAGAGATGGAGTCAGG + Intronic
1011931673 6:92722734-92722756 GGGTTCTTACAAATGGAGGAGGG - Intergenic
1013352643 6:109319308-109319330 AGGTTTTTCCAGAGGAAGTTAGG + Intergenic
1014376576 6:120682531-120682553 ATGTTTTTATAAATGGTGTAAGG - Intergenic
1014404920 6:121039523-121039545 AAGTTTTTAAAGATGGTGTCTGG + Intergenic
1014565749 6:122945671-122945693 ATGTTATAACAGTTGGAGTATGG - Intergenic
1014901686 6:126973315-126973337 AGGTTTTAAGAAATGGAGAATGG + Intergenic
1015551774 6:134419453-134419475 AAGTTTTTCCAGGTGAAGTATGG - Intergenic
1016423302 6:143907944-143907966 TGATTTTTGCAGATGGTGTAAGG + Intronic
1016487470 6:144557641-144557663 AGGTGTTTACAGATGCATCAGGG + Intronic
1017020521 6:150136427-150136449 AGGTTTCTACAGATGAATTTTGG + Intergenic
1017557745 6:155590385-155590407 TGGTTTTGCCAGATGGAATATGG + Intergenic
1018363192 6:163093546-163093568 AAGCTTTTACAGCTGGAATATGG + Intronic
1018990874 6:168672772-168672794 ATGTGTTTTCAGATGGAGTGAGG + Intronic
1021083674 7:16393558-16393580 TGGAGTTTACAGATTGAGTAGGG - Intronic
1024801035 7:53078751-53078773 CTGTTTTTACAGATTGAATAGGG - Intergenic
1028265060 7:88713558-88713580 AGGTTGTTACATTGGGAGTAGGG - Intergenic
1028318701 7:89435355-89435377 AGTTTTTAAGAGCTGGAGTAGGG - Intergenic
1028713368 7:93936489-93936511 AGGTTTTCAATGATGGAATACGG + Intergenic
1029375746 7:100176105-100176127 GAGTCTTCACAGATGGAGTAAGG + Intronic
1029687512 7:102158882-102158904 GGGTGTTTAGAGATGGAGTAGGG - Intronic
1032357411 7:131223611-131223633 AGCATTTTAGAGATGGAGAATGG - Intronic
1032998878 7:137480914-137480936 AGGCATTTATAGATGTAGTAGGG - Intronic
1033511529 7:142064537-142064559 AGGTTGTGACAGCTGGAGAAGGG - Intronic
1033514591 7:142093565-142093587 AGGTTGTGACAGCTGGAGAAGGG - Intronic
1035055619 7:156034015-156034037 AGGTAATTCTAGATGGAGTAAGG + Intergenic
1035980062 8:4360499-4360521 AGGTTCTTTGAGATGGAGTCTGG + Intronic
1036044707 8:5126877-5126899 AGTCCTTTACAGATGGAGTCAGG + Intergenic
1036138877 8:6188031-6188053 AGATTTTCACATATGGAGTCAGG - Intergenic
1038010383 8:23471245-23471267 GGGATTTTACAGATTGATTAAGG - Intergenic
1038466993 8:27773395-27773417 AGGTTTTTAAAGACGAAGAAGGG - Intronic
1039635404 8:39159321-39159343 TGGTTTTTACAGATTGACTCTGG + Intronic
1039834204 8:41243526-41243548 GGGTTTTTGCAGATGTAGTTAGG + Intergenic
1040039843 8:42904797-42904819 AGCTTGGTACAGATCGAGTAGGG - Intronic
1044153951 8:88819254-88819276 AGCTTTTTAAAGATGTAGAATGG - Intergenic
1044190715 8:89313559-89313581 TGGCTTTTACATATAGAGTAAGG + Intergenic
1044206503 8:89497067-89497089 ATTTTTTTACAGATGGGGAAAGG - Intergenic
1044868785 8:96598261-96598283 AGGTTTTAACACATGGATTTTGG + Intronic
1046024054 8:108700802-108700824 AGGTTTACACAGCTGGAGCATGG + Intronic
1047053259 8:121137175-121137197 AGGTTGTTACAAATGCATTAAGG + Intergenic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1052159162 9:25234124-25234146 GGGTTCTTACAAATGAAGTAAGG - Intergenic
1052384551 9:27808093-27808115 AGTTTTTAAGAGCTGGAGTAGGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1060731157 9:126037877-126037899 ATCATTTTACAGATGGAGTACGG - Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1187999994 X:24971880-24971902 AGGATTTTAAAGATGGAGGGGGG + Intronic
1188193708 X:27204206-27204228 ATATCATTACAGATGGAGTAGGG - Intergenic
1189943259 X:46150279-46150301 AGGTTTTTATAGACAGCGTATGG + Intergenic
1190299388 X:49047727-49047749 GGGTTTTTAGAGATAGAGTTCGG + Intergenic
1190515335 X:51218101-51218123 TGTTTTTTAGAGATGGAGTCTGG + Intergenic
1192797963 X:74440159-74440181 AGGGTTTTAGAGAGGGAGTAGGG + Intronic
1192873490 X:75206465-75206487 AGTTTTTAAGAGCTGGAGTAGGG + Intergenic
1197909790 X:131468983-131469005 AGGAATAAACAGATGGAGTAAGG - Intergenic
1198274445 X:135087954-135087976 TGGTTGTTACAGATGGATTCTGG + Intergenic
1199033712 X:143028894-143028916 AGCTTTTAAAAGCTGGAGTAGGG + Intronic
1199093733 X:143717651-143717673 AGTTTTTAAAAGCTGGAGTAGGG - Intronic
1201337689 Y:12897932-12897954 ATGTTCTTACAGCTGAAGTAGGG + Intergenic
1201948722 Y:19540291-19540313 TTGTTTTTTCAGATGGAGTCTGG - Intergenic