ID: 1054490841

View in Genome Browser
Species Human (GRCh38)
Location 9:65773709-65773731
Sequence AGTTAACTGGAGAAGATGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054490841_1054490844 14 Left 1054490841 9:65773709-65773731 CCGGTCATCTTCTCCAGTTAACT No data
Right 1054490844 9:65773746-65773768 AGACAGCTCTTGTCCTATACTGG No data
1054490841_1054490846 24 Left 1054490841 9:65773709-65773731 CCGGTCATCTTCTCCAGTTAACT No data
Right 1054490846 9:65773756-65773778 TGTCCTATACTGGGCTTTTGTGG No data
1054490841_1054490845 15 Left 1054490841 9:65773709-65773731 CCGGTCATCTTCTCCAGTTAACT No data
Right 1054490845 9:65773747-65773769 GACAGCTCTTGTCCTATACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054490841 Original CRISPR AGTTAACTGGAGAAGATGAC CGG (reversed) Intergenic
No off target data available for this crispr