ID: 1054490882

View in Genome Browser
Species Human (GRCh38)
Location 9:65774025-65774047
Sequence CCCCATGAGGTCATCAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054490882_1054490887 7 Left 1054490882 9:65774025-65774047 CCTGCACTGATGACCTCATGGGG No data
Right 1054490887 9:65774055-65774077 TTTGAGCAGTTGACACAGGAAGG No data
1054490882_1054490885 3 Left 1054490882 9:65774025-65774047 CCTGCACTGATGACCTCATGGGG No data
Right 1054490885 9:65774051-65774073 TGCCTTTGAGCAGTTGACACAGG No data
1054490882_1054490891 18 Left 1054490882 9:65774025-65774047 CCTGCACTGATGACCTCATGGGG No data
Right 1054490891 9:65774066-65774088 GACACAGGAAGGGAGGACTAGGG No data
1054490882_1054490889 11 Left 1054490882 9:65774025-65774047 CCTGCACTGATGACCTCATGGGG No data
Right 1054490889 9:65774059-65774081 AGCAGTTGACACAGGAAGGGAGG No data
1054490882_1054490892 23 Left 1054490882 9:65774025-65774047 CCTGCACTGATGACCTCATGGGG No data
Right 1054490892 9:65774071-65774093 AGGAAGGGAGGACTAGGGCCTGG No data
1054490882_1054490888 8 Left 1054490882 9:65774025-65774047 CCTGCACTGATGACCTCATGGGG No data
Right 1054490888 9:65774056-65774078 TTGAGCAGTTGACACAGGAAGGG No data
1054490882_1054490890 17 Left 1054490882 9:65774025-65774047 CCTGCACTGATGACCTCATGGGG No data
Right 1054490890 9:65774065-65774087 TGACACAGGAAGGGAGGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054490882 Original CRISPR CCCCATGAGGTCATCAGTGC AGG (reversed) Intergenic
No off target data available for this crispr