ID: 1054494600

View in Genome Browser
Species Human (GRCh38)
Location 9:65817846-65817868
Sequence GATTTGCCCTGCCCCAACGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054494600_1054494606 18 Left 1054494600 9:65817846-65817868 CCAACGTTGGGGCAGGGCAAATC No data
Right 1054494606 9:65817887-65817909 GTCCAGCTCTGGCCCTGCCTTGG No data
1054494600_1054494603 7 Left 1054494600 9:65817846-65817868 CCAACGTTGGGGCAGGGCAAATC No data
Right 1054494603 9:65817876-65817898 GACACCTCCAAGTCCAGCTCTGG No data
1054494600_1054494608 24 Left 1054494600 9:65817846-65817868 CCAACGTTGGGGCAGGGCAAATC No data
Right 1054494608 9:65817893-65817915 CTCTGGCCCTGCCTTGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054494600 Original CRISPR GATTTGCCCTGCCCCAACGT TGG (reversed) Intergenic
No off target data available for this crispr