ID: 1054505835

View in Genome Browser
Species Human (GRCh38)
Location 9:65911079-65911101
Sequence GGCACTGATGTGATGCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054505828_1054505835 5 Left 1054505828 9:65911051-65911073 CCTTCTTTTTTGAGCTCCATCCC No data
Right 1054505835 9:65911079-65911101 GGCACTGATGTGATGCCAGCAGG No data
1054505827_1054505835 11 Left 1054505827 9:65911045-65911067 CCTGCTCCTTCTTTTTTGAGCTC No data
Right 1054505835 9:65911079-65911101 GGCACTGATGTGATGCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054505835 Original CRISPR GGCACTGATGTGATGCCAGC AGG Intergenic
No off target data available for this crispr