ID: 1054511626

View in Genome Browser
Species Human (GRCh38)
Location 9:65987550-65987572
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054511618_1054511626 16 Left 1054511618 9:65987511-65987533 CCTTGGTTACACAAAGTCATACA No data
Right 1054511626 9:65987550-65987572 TTGGAGACTCAGAGCGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054511626 Original CRISPR TTGGAGACTCAGAGCGGGGA GGG Intergenic
No off target data available for this crispr