ID: 1054516073

View in Genome Browser
Species Human (GRCh38)
Location 9:66039905-66039927
Sequence ACAGCTTGTGGGCTGAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054516068_1054516073 -6 Left 1054516068 9:66039888-66039910 CCAAGCTTGTCTAACCCACAGCT No data
Right 1054516073 9:66039905-66039927 ACAGCTTGTGGGCTGAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054516073 Original CRISPR ACAGCTTGTGGGCTGAATGC AGG Intergenic
No off target data available for this crispr