ID: 1054517734

View in Genome Browser
Species Human (GRCh38)
Location 9:66053081-66053103
Sequence AGAGACTGTCCCTGCTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054517734_1054517740 21 Left 1054517734 9:66053081-66053103 CCCACACAGCAGGGACAGTCTCT No data
Right 1054517740 9:66053125-66053147 GACTGATCCATGTCACTCTAAGG 0: 4
1: 2
2: 3
3: 8
4: 94
1054517734_1054517737 -6 Left 1054517734 9:66053081-66053103 CCCACACAGCAGGGACAGTCTCT No data
Right 1054517737 9:66053098-66053120 GTCTCTTCCATTTACCTTCAGGG 0: 4
1: 0
2: 4
3: 24
4: 244
1054517734_1054517742 30 Left 1054517734 9:66053081-66053103 CCCACACAGCAGGGACAGTCTCT No data
Right 1054517742 9:66053134-66053156 ATGTCACTCTAAGGCAACCAAGG 0: 4
1: 2
2: 12
3: 14
4: 142
1054517734_1054517736 -7 Left 1054517734 9:66053081-66053103 CCCACACAGCAGGGACAGTCTCT No data
Right 1054517736 9:66053097-66053119 AGTCTCTTCCATTTACCTTCAGG 0: 4
1: 0
2: 4
3: 35
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054517734 Original CRISPR AGAGACTGTCCCTGCTGTGT GGG (reversed) Intergenic
No off target data available for this crispr