ID: 1054517736

View in Genome Browser
Species Human (GRCh38)
Location 9:66053097-66053119
Sequence AGTCTCTTCCATTTACCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 4, 1: 0, 2: 4, 3: 35, 4: 199}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054517734_1054517736 -7 Left 1054517734 9:66053081-66053103 CCCACACAGCAGGGACAGTCTCT No data
Right 1054517736 9:66053097-66053119 AGTCTCTTCCATTTACCTTCAGG 0: 4
1: 0
2: 4
3: 35
4: 199
1054517732_1054517736 0 Left 1054517732 9:66053074-66053096 CCAGCCTCCCACACAGCAGGGAC No data
Right 1054517736 9:66053097-66053119 AGTCTCTTCCATTTACCTTCAGG 0: 4
1: 0
2: 4
3: 35
4: 199
1054517728_1054517736 7 Left 1054517728 9:66053067-66053089 CCCTAGACCAGCCTCCCACACAG 0: 7
1: 3
2: 0
3: 38
4: 302
Right 1054517736 9:66053097-66053119 AGTCTCTTCCATTTACCTTCAGG 0: 4
1: 0
2: 4
3: 35
4: 199
1054517724_1054517736 24 Left 1054517724 9:66053050-66053072 CCTGCCAAGTCCTCCATCCCTAG No data
Right 1054517736 9:66053097-66053119 AGTCTCTTCCATTTACCTTCAGG 0: 4
1: 0
2: 4
3: 35
4: 199
1054517729_1054517736 6 Left 1054517729 9:66053068-66053090 CCTAGACCAGCCTCCCACACAGC 0: 7
1: 3
2: 3
3: 63
4: 845
Right 1054517736 9:66053097-66053119 AGTCTCTTCCATTTACCTTCAGG 0: 4
1: 0
2: 4
3: 35
4: 199
1054517725_1054517736 20 Left 1054517725 9:66053054-66053076 CCAAGTCCTCCATCCCTAGACCA No data
Right 1054517736 9:66053097-66053119 AGTCTCTTCCATTTACCTTCAGG 0: 4
1: 0
2: 4
3: 35
4: 199
1054517735_1054517736 -8 Left 1054517735 9:66053082-66053104 CCACACAGCAGGGACAGTCTCTT No data
Right 1054517736 9:66053097-66053119 AGTCTCTTCCATTTACCTTCAGG 0: 4
1: 0
2: 4
3: 35
4: 199
1054517726_1054517736 14 Left 1054517726 9:66053060-66053082 CCTCCATCCCTAGACCAGCCTCC 0: 17
1: 10
2: 4
3: 50
4: 440
Right 1054517736 9:66053097-66053119 AGTCTCTTCCATTTACCTTCAGG 0: 4
1: 0
2: 4
3: 35
4: 199
1054517733_1054517736 -4 Left 1054517733 9:66053078-66053100 CCTCCCACACAGCAGGGACAGTC No data
Right 1054517736 9:66053097-66053119 AGTCTCTTCCATTTACCTTCAGG 0: 4
1: 0
2: 4
3: 35
4: 199
1054517727_1054517736 11 Left 1054517727 9:66053063-66053085 CCATCCCTAGACCAGCCTCCCAC 0: 7
1: 15
2: 5
3: 31
4: 403
Right 1054517736 9:66053097-66053119 AGTCTCTTCCATTTACCTTCAGG 0: 4
1: 0
2: 4
3: 35
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054517736 Original CRISPR AGTCTCTTCCATTTACCTTC AGG Intergenic
900876280 1:5344996-5345018 ACTGTCTTCCACTTACCTTCTGG - Intergenic
902174888 1:14641583-14641605 AGTCTCTTCCATTTTGTTTTTGG - Intronic
903605554 1:24572781-24572803 AGTCTCTTCCACTTTTCCTCTGG + Intronic
904364720 1:30002929-30002951 AATCTCTTCTATTTTCTTTCCGG + Intergenic
906127194 1:43434193-43434215 CGTCTCTTCCATTTCCCACCAGG + Intronic
906556213 1:46716669-46716691 AGGTTCTTCCTTTTACCTGCAGG - Intronic
906783868 1:48597061-48597083 ATCCTCTTCCTTTCACCTTCTGG + Intronic
908160092 1:61398444-61398466 AGTCTATTCCATTTGAATTCAGG - Intronic
908293895 1:62693983-62694005 AGTCTCCTCCAATTCCGTTCTGG + Intergenic
912048159 1:105486976-105486998 ACTCTTTTCCTTTTACTTTCTGG - Intergenic
912208397 1:107533014-107533036 AGTCTCTTTCCTCTACCTGCTGG - Intergenic
913463554 1:119115542-119115564 GATCTCTTCCATTTGCCATCTGG - Intronic
913563333 1:120045821-120045843 AAACTCTTCAATTTACATTCTGG + Intronic
913634789 1:120747759-120747781 AAACTCTTCAATTTACATTCTGG - Intergenic
914283930 1:146205182-146205204 AAACTCTTCAATTTACATTCTGG + Intronic
914375908 1:147073382-147073404 AGTCTCTTCCAATAACTTTAGGG + Intergenic
914544961 1:148655921-148655943 AAACTCTTCAATTTACATTCTGG + Intronic
914621609 1:149414767-149414789 AAACTCTTCAATTTACATTCTGG - Intergenic
914847407 1:151290693-151290715 AGTTTCTTCCACTTTTCTTCAGG + Exonic
916385884 1:164268570-164268592 ATTTTCTTCCTTATACCTTCTGG - Intergenic
916389225 1:164312372-164312394 ACTCTCTTTCATTTACTCTCAGG + Intergenic
918547438 1:185700877-185700899 AGTTTCTTTCACTTGCCTTCTGG + Intergenic
919216101 1:194557127-194557149 AGTGTCTTTCCTTTATCTTCAGG + Intergenic
919857853 1:201717918-201717940 AGTCTCTCCCACTTGCCTCCAGG + Intronic
920686302 1:208111394-208111416 AGCCTCTTCCATTATCGTTCTGG - Intronic
921798371 1:219373955-219373977 AATCTCTTCCTTTTTCCTTTTGG - Intergenic
1064841598 10:19598427-19598449 ATTCTCTCCCTTTTACTTTCTGG - Intronic
1065444339 10:25782022-25782044 AGTCTGTTCCATTGTCCTTCAGG + Intergenic
1066220503 10:33333981-33334003 AGTCTCTTCTAATTGCCTTTGGG + Intronic
1074953672 10:118366202-118366224 AGTCATTTCCATTTACTGTCAGG - Intergenic
1075094797 10:119464064-119464086 TGTTTCTTCCATTTGTCTTCTGG - Intergenic
1077921168 11:6642732-6642754 AGTGGCTTCCATTTGCCTTTAGG - Intronic
1079971582 11:27041791-27041813 TGTCTCTTCTGTTTACTTTCTGG - Intronic
1081848995 11:46261833-46261855 AGTGGCTCCCATTTGCCTTCAGG + Intergenic
1083156820 11:60828457-60828479 AGTCTCTTCCCTGCCCCTTCAGG - Intergenic
1084291136 11:68168804-68168826 AGCCTCTTCCTTTTACCCTCTGG + Intronic
1084981871 11:72833435-72833457 AGGCTCATCCCTTCACCTTCTGG - Intronic
1085056479 11:73407118-73407140 ATTCTGTGCCATTTACCTTATGG - Intronic
1087114076 11:94504897-94504919 GGTCTTTTCCATTTACAGTCAGG + Intergenic
1088362386 11:109004551-109004573 AGTCTCTCCCATTTCCATTCTGG - Intergenic
1088585407 11:111356433-111356455 TGTCTCTTCCATTTCCCTCCAGG - Intronic
1090300766 11:125636557-125636579 AGTCTCATCAATTTACATTAAGG + Intronic
1095870124 12:47017849-47017871 ACTTTCTTTCATTTTCCTTCAGG + Intergenic
1099192363 12:79573631-79573653 AATTTAATCCATTTACCTTCAGG - Intergenic
1099339916 12:81417133-81417155 AGTGTATTCCATTTGCTTTCGGG + Intronic
1099587911 12:84545013-84545035 TTTCTTTTCCCTTTACCTTCTGG + Intergenic
1099895375 12:88639593-88639615 AGTCTCTTCCATCTTCATTATGG - Intergenic
1100997773 12:100321163-100321185 ACTCTCTTACATTTGCCTTTTGG + Intronic
1103194991 12:119036360-119036382 GGTCTCTTCCATTTGCTTCCAGG + Intronic
1104477657 12:129083856-129083878 AGTCTCCACCATCTACCGTCAGG - Intronic
1105256102 13:18744865-18744887 AGTCTCCTACCCTTACCTTCAGG + Intergenic
1106093825 13:26624501-26624523 AGTATCTTCTCTTTTCCTTCTGG - Intronic
1109773393 13:67006355-67006377 AGCCTCTTCCATTTCTATTCCGG - Intronic
1112783513 13:102927493-102927515 GGGCTCTGCCATTTCCCTTCTGG + Intergenic
1115189716 14:30734193-30734215 AATCTCATGAATTTACCTTCAGG + Intronic
1116041821 14:39695019-39695041 AGTGACTTCCATTTGCCTTTAGG + Intergenic
1118764307 14:68899761-68899783 AGTCTCTCCCCTTCTCCTTCAGG - Intronic
1119259509 14:73229139-73229161 AGCCTCTCCCACTTACCTGCGGG - Intergenic
1119669300 14:76506580-76506602 AGTCTCTTCCACTTCCCTTGTGG + Intergenic
1121882236 14:97511308-97511330 AGTTCCTTCCATTTTCCTACTGG + Intergenic
1202835908 14_GL000009v2_random:77163-77185 AGTCTCCTACCTTTACCTTCAGG - Intergenic
1125154800 15:36573602-36573624 AGTCTCTTACATTTTCTCTCAGG - Intergenic
1126729229 15:51665094-51665116 AGTCTCTTCTATTAACAGTCTGG + Intergenic
1127511020 15:59641484-59641506 AGTCTTTTCTATTTACTTTCTGG + Intronic
1127582503 15:60350561-60350583 AGGCTTTTGCATTTTCCTTCTGG - Intronic
1128584176 15:68833373-68833395 AGTGGCATCCATTTAGCTTCAGG - Intronic
1129065122 15:72896360-72896382 AGTTTCTCCCAGTTTCCTTCTGG + Intergenic
1129976908 15:79830360-79830382 AGTCTCTGAAATTTCCCTTCTGG + Intergenic
1135293589 16:21260835-21260857 GGTCTCTGCCATTTCCCTTAAGG + Intronic
1138590901 16:57999309-57999331 AGTTTCTTACATTTTCCTGCAGG - Intronic
1139028927 16:62855456-62855478 GGTCCCTAACATTTACCTTCAGG + Intergenic
1140433680 16:74926772-74926794 AGTCATTTCCATTTCCATTCAGG - Intronic
1140701938 16:77589067-77589089 GGGCTCTACCACTTACCTTCTGG - Intergenic
1143096175 17:4479650-4479672 AGTCTGGTCCATTTCCCTTGTGG - Intronic
1143579996 17:7819877-7819899 ATTCTCTTCCCTCTTCCTTCAGG + Intronic
1144639618 17:16930360-16930382 AGGCTCTTCCCTTCACCTCCAGG + Intronic
1146943710 17:36860424-36860446 TGTCTCTTCCATTAAACTCCAGG - Intergenic
1147165638 17:38591762-38591784 AGTCACTTCCATTTGCTTTCTGG + Intronic
1147770704 17:42866233-42866255 AGTCTCTTCCAGTTCCCCTCAGG + Intergenic
1149351784 17:55796343-55796365 AGTCTATACTATTTACCATCTGG + Intronic
1150845769 17:68656452-68656474 AGTATCTTTCATTTATCTTTTGG - Intergenic
1152011117 17:77718161-77718183 AGTTTCTTCACTTTACCTACTGG + Intergenic
1152380471 17:79939841-79939863 AGACTCTTCCACTTCCCTTCAGG - Exonic
1153621277 18:6980505-6980527 AGTCCTTTCCACTTACCTTTAGG + Exonic
1154083232 18:11278353-11278375 AGTGCCTTACATTTTCCTTCTGG - Intergenic
1154434931 18:14335813-14335835 AGTCTGCTACCTTTACCTTCAGG - Intergenic
1157637134 18:49169698-49169720 AGTCTCTACCATGGAACTTCAGG + Intronic
1159889001 18:73936915-73936937 AATCTGTTCCATTGAACTTCGGG - Intergenic
1160027243 18:75228646-75228668 AGTCTTTTTCATTTTGCTTCAGG + Intronic
1160248820 18:77183439-77183461 ACTCTCTTTCATTGACCTTGGGG - Intergenic
1163693249 19:18749145-18749167 AGGCTCTTCCCTCTACCTCCAGG - Intronic
1164385194 19:27765930-27765952 AGTCTCTTCCATTAAAATTCTGG + Intergenic
1164504619 19:28849398-28849420 AGTCACTTGTAATTACCTTCAGG + Intergenic
1202636729 1_KI270706v1_random:50199-50221 AGTCTCCTACCTTTACCTTCAGG + Intergenic
925504074 2:4541536-4541558 TGTCTCTTCCATTGACCTTAAGG - Intergenic
928207227 2:29294256-29294278 ATTCTCTTCCCTCTTCCTTCAGG - Intronic
929430537 2:41882494-41882516 AGTCTCTTGCCTTTACACTCTGG - Intergenic
931904149 2:66824268-66824290 TGTCTCTATCATTTAACTTCTGG - Intergenic
937805240 2:126133736-126133758 AGTCTCAACCTTTTACTTTCTGG - Intergenic
938279013 2:130051645-130051667 AGTCTCTTATCTTCACCTTCAGG + Intergenic
938329996 2:130442521-130442543 AGTCTCTTATCTTCACCTTCAGG + Intergenic
938359949 2:130678982-130679004 AGTCTCTTATCTTCACCTTCAGG - Intergenic
938673787 2:133610276-133610298 TGTCTCTTTCATTAACCCTCTGG - Intergenic
939446697 2:142319578-142319600 AATATCTTCCCTTTACCTTCGGG + Intergenic
942379331 2:175371918-175371940 ACTCTCTTCCATTCACCCACAGG - Intergenic
942895683 2:181051034-181051056 AGTCTCATTCCTTTTCCTTCCGG + Intronic
944740987 2:202612553-202612575 CATCTCTTGAATTTACCTTCTGG - Intergenic
944910688 2:204307786-204307808 AATCTCTTTCATTTCCTTTCTGG - Intergenic
946508519 2:220327758-220327780 AGTATCTTCTATTCACATTCTGG + Intergenic
946982571 2:225233468-225233490 AGTCACCTCCAAGTACCTTCAGG - Intergenic
947094229 2:226547859-226547881 TGTATTTTCCATTTACCTTCTGG + Intergenic
947127405 2:226884263-226884285 ACTGTTTTCCATTTACATTCAGG + Intronic
1168981883 20:2011271-2011293 TCTCTCTGCCACTTACCTTCAGG + Intergenic
1169710072 20:8551234-8551256 AATCTCTTCCAGTGATCTTCTGG - Intronic
1170195819 20:13688626-13688648 ACTCTCTTCCTTTTCCCTCCAGG + Intergenic
1171880839 20:30616616-30616638 AATCTCTTACCTTCACCTTCAGG + Intergenic
1171882856 20:30631130-30631152 AGTCTCCTACCTTTACCTTCAGG + Intergenic
1173793766 20:45844420-45844442 ACCCTCTTCCCTTTACTTTCAGG - Exonic
1173943307 20:46930572-46930594 TCTCTCTTCCAGTTATCTTCTGG - Intronic
1175842190 20:62035621-62035643 AGACTATTCCTATTACCTTCGGG + Intronic
1175897140 20:62343194-62343216 AGTCTATGACATTTACCGTCTGG + Intronic
1176309482 21:5142116-5142138 AGTCTCTTCCTGTCACCTCCAGG + Intronic
1176842104 21:13849889-13849911 AGTCTCCTACCTTTACCTTCAGG + Intergenic
1178570828 21:33735494-33735516 TTTCTCTTCCATTATCCTTCAGG + Intronic
1178980001 21:37255729-37255751 AGTTTCTGCCATTTTCCTCCTGG - Intronic
1179847578 21:44119917-44119939 AGTCTCTTCCTGTCACCTCCAGG - Intronic
1180103736 21:45603202-45603224 AATTTCATCCATTTACCTTCAGG + Intergenic
1180364140 22:11924114-11924136 AGTCTCCTACCTTTACCTTCAGG - Intergenic
1181836251 22:25611732-25611754 AGTCTCTTTCATTTTCCTAATGG + Intronic
1184843187 22:47064451-47064473 AGTCTGATCCATTTACCTGATGG + Intronic
950158163 3:10739381-10739403 AGCCCCTTGCACTTACCTTCAGG - Intergenic
950349283 3:12331665-12331687 AGTCTCTTCCACTTACCAACTGG - Intronic
951476733 3:23114440-23114462 AGTCTCTTCCATTTTTGTTGAGG - Intergenic
952243503 3:31560166-31560188 AGTTTAATCCATTTACATTCAGG + Intronic
953222305 3:40983737-40983759 TGTATCTTACATTTCCCTTCTGG - Intergenic
953920338 3:46947273-46947295 TGTCTCTTCCTGTCACCTTCAGG - Intronic
955545774 3:60028204-60028226 ATTCTCTTCTATTTAACTTTTGG + Intronic
955871049 3:63438831-63438853 AGCCTCTTCCATTTTGCTTCAGG - Intronic
957266706 3:77976055-77976077 ATTATCTTCCATTTTCCTTCTGG + Intergenic
958147448 3:89644481-89644503 AGTCTTTTCCTCTTACATTCTGG + Intergenic
958485548 3:94703042-94703064 ACTCTTTTGCATTTAACTTCTGG - Intergenic
959872041 3:111340036-111340058 AGTCTCTTGCAGCTACCTACAGG + Intronic
961513461 3:127418711-127418733 AGTCTCTACCATTTACCCACTGG - Intergenic
961630468 3:128294921-128294943 AATCTCTTGCATGTACCTCCAGG + Intronic
962548164 3:136458684-136458706 AATTTAATCCATTTACCTTCAGG - Intronic
963046052 3:141103465-141103487 AGTCTTTTCCATTCATTTTCAGG - Intronic
965337266 3:167442123-167442145 AATCTCTTCCTTTTATCTCCTGG + Exonic
965658644 3:171017475-171017497 AGTATCTTTCATTTTCCTTGGGG + Intronic
966149190 3:176848169-176848191 AGGCTATTGCATCTACCTTCAGG - Intergenic
970185938 4:13453924-13453946 TGTCTCTTCTCTTTTCCTTCTGG + Intronic
973394072 4:49578865-49578887 AGTCTCCTACTTTTACCTTCAGG - Intergenic
975206756 4:71652540-71652562 AGTTTCTTCCATTGACTTCCAGG - Intergenic
976408289 4:84684158-84684180 GCTCCCTTCCAATTACCTTCTGG + Intronic
976670419 4:87646222-87646244 AATCTTTTCCATTTAAATTCAGG + Intergenic
977112025 4:92969083-92969105 AGTCACTTACATTTACCTTTGGG + Intronic
978651122 4:111006347-111006369 AGACTCTTACCTTTACCTCCAGG - Intergenic
979822311 4:125190000-125190022 ACTTTCTTCCATTCACCTTCTGG - Intergenic
981568034 4:146121678-146121700 AATCTCTTCTATTTATCTCCAGG + Intergenic
981793920 4:148573275-148573297 AGGCTCTTCCATTAACATCCAGG - Intergenic
983118641 4:163851807-163851829 AATCTCTTCCATTTCCCCTGTGG + Intronic
983982846 4:174020177-174020199 AGTATCTTCCTTTTAACTTTGGG - Intergenic
983997067 4:174195436-174195458 ATTCTCTTCCTTTTTTCTTCTGG - Intergenic
985388980 4:189474931-189474953 AGTCTCTGCCTTTTGCCTTAAGG - Intergenic
1202764044 4_GL000008v2_random:136071-136093 AGTCTCCTACCTTTACCTTCAGG + Intergenic
985886498 5:2684409-2684431 AGTCTCTACCTTTTATTTTCTGG - Intergenic
986505943 5:8451400-8451422 AGCCTCTTACTTTTACCTTTAGG - Intergenic
987039285 5:14046650-14046672 AATCTCTTTCCTTTTCCTTCTGG + Intergenic
989751494 5:44899665-44899687 AATCTCTTCCTTTACCCTTCAGG - Intergenic
990054280 5:51551087-51551109 AGTCTCTTATATTTTCCTTATGG - Intergenic
990731705 5:58815900-58815922 AGTCTCTTCCATCTTCCTCTGGG - Intronic
990804667 5:59645543-59645565 AGTCTCTTCCCTGTACCCTTAGG + Intronic
991522420 5:67515597-67515619 AGTCTGTTTCCTTCACCTTCCGG + Intergenic
993846540 5:92951557-92951579 AGTTTTATCCATTTACATTCAGG + Intergenic
998352079 5:141508461-141508483 ATTCTCTTTCTTTTACATTCTGG + Intronic
1005774961 6:29121041-29121063 AGTATCTTCCCTTTGACTTCTGG + Intergenic
1006193500 6:32223384-32223406 AGTCTCAGCCATTCACCTCCCGG - Intronic
1009507265 6:64500237-64500259 TGTCTATTCCATTTACCTTGTGG - Intronic
1009507327 6:64501258-64501280 TGTCTATTCCATTTACCTTGTGG + Intronic
1012628497 6:101433270-101433292 TTTCTTTTCAATTTACCTTCTGG + Intronic
1012799738 6:103809876-103809898 AGTTTCTTCCACTTGCCTTCTGG - Intergenic
1014634136 6:123824173-123824195 GGCCTCTTCCACTTACTTTCAGG - Intronic
1016315894 6:142786471-142786493 GGTCTCTTCCATTAACCTGCAGG - Intronic
1016354692 6:143205277-143205299 AATCTCTTCCAATCCCCTTCTGG + Intronic
1017645632 6:156537536-156537558 TGTCTCTTCCAAATACCTTTGGG - Intergenic
1020686714 7:11305212-11305234 AATCTCTCTCATTTCCCTTCAGG - Intergenic
1024373740 7:48615465-48615487 AGTATGTTCCAATTACCTGCTGG + Intronic
1024577892 7:50779893-50779915 AGACTCTTCCAGCTGCCTTCAGG + Intronic
1024827450 7:53408015-53408037 AGTCTCTTCCCTTTATCTCAAGG + Intergenic
1025108000 7:56188936-56188958 TCTCTCTTTCATTTTCCTTCAGG + Intergenic
1026310246 7:69177127-69177149 TCTCTCTTTCATTTTCCTTCAGG - Intergenic
1027889980 7:83960785-83960807 AGTGTATTCCATTTTTCTTCTGG + Exonic
1031970619 7:128062423-128062445 AGTCCCTTCCTTTCACCCTCTGG + Intronic
1035193241 7:157190931-157190953 AGTCTCTTCCAGTTAATGTCTGG + Intronic
1036705813 8:11045803-11045825 ACTTTCTTCCATTTTCCTTGTGG - Intronic
1040531406 8:48269364-48269386 GATCTCTTCCATTTACTTTAGGG - Intergenic
1040625559 8:49145551-49145573 AGTGTCTTCCAGTTATCTACTGG - Intergenic
1041683423 8:60617879-60617901 TTTCTCTTCCATCTAGCTTCTGG + Intronic
1041855233 8:62445278-62445300 AGTCTTTTCCATATACCTGTTGG + Intronic
1045369182 8:101504519-101504541 AGTCTCTCCCATGAACATTCAGG - Intronic
1048167941 8:132080202-132080224 AGTCTCCTCCATATGCCTTATGG + Intronic
1048951213 8:139498432-139498454 AGTGTAGTCCATTTAGCTTCTGG - Intergenic
1050080701 9:1912874-1912896 GGTCTCTACCACTTGCCTTCAGG + Intergenic
1050201749 9:3152143-3152165 AGTCTCTTCCATCCACCCCCTGG - Intergenic
1051051241 9:12934137-12934159 TGTCACTTCCACTTACATTCCGG - Intergenic
1051471743 9:17451256-17451278 AGTCTCATTTATTTACATTCTGG + Intronic
1052526167 9:29622157-29622179 AGTCTCTTCCAATTCCAATCTGG - Intergenic
1052880659 9:33599374-33599396 AGTCTCTTAGCTCTACCTTCAGG - Intergenic
1053495314 9:38544836-38544858 AGTCTCTTAGCTCTACCTTCAGG + Intronic
1053666873 9:40323186-40323208 AGTCTCTTCCATTTACCTTCAGG - Intronic
1053916465 9:42948293-42948315 AGTCTCTTCCATTTACCTTCAGG - Intergenic
1054378025 9:64463214-64463236 AGTCTCTTCCATTTACCTTCAGG - Intergenic
1054517736 9:66053097-66053119 AGTCTCTTCCATTTACCTTCAGG + Intergenic
1054743780 9:68834111-68834133 ATTATCTTCCATTGGCCTTCTGG + Intronic
1055207441 9:73750073-73750095 AGTTTTTTCCATTGACCTTGGGG + Intergenic
1055979199 9:81985216-81985238 GGGCTCTGCCATTTACCTCCTGG - Intergenic
1055985915 9:82056475-82056497 AGTCTCTTACATTTACCTTGAGG - Intergenic
1056408556 9:86301368-86301390 TGTCTCTTCCATTTTTCTACTGG + Exonic
1056611455 9:88128282-88128304 AGTCTCTTACCTTTACCTTCAGG - Intergenic
1056686232 9:88763471-88763493 CTTCTCTTCCATTCACCTTAGGG - Intergenic
1057091809 9:92264840-92264862 AGTCACTGCCATTTATCTACTGG - Intronic
1057451466 9:95165273-95165295 AGTCTCTCCCTTTTAACTTTAGG + Intronic
1057675213 9:97132194-97132216 AGTCTCTTACGTTTACCTTCAGG + Intergenic
1059150536 9:111945834-111945856 TGTCTCTTCCTTTTTCCTTCTGG - Intergenic
1060093648 9:120767319-120767341 AGTTTCTTCCATTTTCAGTCTGG - Intronic
1060610352 9:124958366-124958388 ATTCTCTTCCATTGACCTACAGG - Intronic
1203544793 Un_KI270743v1:120944-120966 AGTCTCCTACCTTTACCTTCAGG + Intergenic
1187132373 X:16515328-16515350 AGTAGCTTCCATTCATCTTCTGG + Intergenic
1188445135 X:30247481-30247503 GGTCTCTTCAATTTACACTCAGG - Intronic
1188706027 X:33331641-33331663 AGCACCATCCATTTACCTTCAGG + Intronic
1191248121 X:58244091-58244113 AGTCTCTCCCATTAAAATTCTGG - Intergenic
1194385610 X:93250308-93250330 ATTATCTTACATTTTCCTTCAGG + Intergenic
1194419578 X:93657099-93657121 ATTCTCTTACATTTCCCTTTGGG + Intergenic
1195842223 X:109186663-109186685 AGTCTCTTTCACATCCCTTCAGG + Intergenic
1197086356 X:122480649-122480671 AGTTTCTTCCATGTAGATTCTGG - Intergenic
1197128437 X:122975120-122975142 AGGCTCTTTCATTTACCTTCTGG - Intergenic
1198146848 X:133866529-133866551 AATCTATTTCAATTACCTTCTGG - Intronic
1198737693 X:139805642-139805664 AGCCTCTTCCCTTTACCTGAAGG - Intronic
1200303060 X:154998122-154998144 AATCTTTTCCAGTAACCTTCAGG + Intronic
1200744345 Y:6890288-6890310 AGCCTGTTCCATATACCTTGGGG + Intergenic
1201438084 Y:13980793-13980815 AGTTTCTTCCCTTTCCCTCCGGG + Intergenic
1201781744 Y:17730542-17730564 ATTCTCTTCCACTTATCTGCTGG - Intergenic
1201819809 Y:18175448-18175470 ATTCTCTTCCACTTATCTGCTGG + Intergenic