ID: 1054517737

View in Genome Browser
Species Human (GRCh38)
Location 9:66053098-66053120
Sequence GTCTCTTCCATTTACCTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 4, 1: 0, 2: 4, 3: 24, 4: 244}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054517726_1054517737 15 Left 1054517726 9:66053060-66053082 CCTCCATCCCTAGACCAGCCTCC 0: 17
1: 10
2: 4
3: 50
4: 440
Right 1054517737 9:66053098-66053120 GTCTCTTCCATTTACCTTCAGGG 0: 4
1: 0
2: 4
3: 24
4: 244
1054517734_1054517737 -6 Left 1054517734 9:66053081-66053103 CCCACACAGCAGGGACAGTCTCT No data
Right 1054517737 9:66053098-66053120 GTCTCTTCCATTTACCTTCAGGG 0: 4
1: 0
2: 4
3: 24
4: 244
1054517733_1054517737 -3 Left 1054517733 9:66053078-66053100 CCTCCCACACAGCAGGGACAGTC No data
Right 1054517737 9:66053098-66053120 GTCTCTTCCATTTACCTTCAGGG 0: 4
1: 0
2: 4
3: 24
4: 244
1054517724_1054517737 25 Left 1054517724 9:66053050-66053072 CCTGCCAAGTCCTCCATCCCTAG No data
Right 1054517737 9:66053098-66053120 GTCTCTTCCATTTACCTTCAGGG 0: 4
1: 0
2: 4
3: 24
4: 244
1054517732_1054517737 1 Left 1054517732 9:66053074-66053096 CCAGCCTCCCACACAGCAGGGAC No data
Right 1054517737 9:66053098-66053120 GTCTCTTCCATTTACCTTCAGGG 0: 4
1: 0
2: 4
3: 24
4: 244
1054517725_1054517737 21 Left 1054517725 9:66053054-66053076 CCAAGTCCTCCATCCCTAGACCA No data
Right 1054517737 9:66053098-66053120 GTCTCTTCCATTTACCTTCAGGG 0: 4
1: 0
2: 4
3: 24
4: 244
1054517727_1054517737 12 Left 1054517727 9:66053063-66053085 CCATCCCTAGACCAGCCTCCCAC 0: 7
1: 15
2: 5
3: 31
4: 403
Right 1054517737 9:66053098-66053120 GTCTCTTCCATTTACCTTCAGGG 0: 4
1: 0
2: 4
3: 24
4: 244
1054517735_1054517737 -7 Left 1054517735 9:66053082-66053104 CCACACAGCAGGGACAGTCTCTT No data
Right 1054517737 9:66053098-66053120 GTCTCTTCCATTTACCTTCAGGG 0: 4
1: 0
2: 4
3: 24
4: 244
1054517729_1054517737 7 Left 1054517729 9:66053068-66053090 CCTAGACCAGCCTCCCACACAGC 0: 7
1: 3
2: 3
3: 63
4: 845
Right 1054517737 9:66053098-66053120 GTCTCTTCCATTTACCTTCAGGG 0: 4
1: 0
2: 4
3: 24
4: 244
1054517728_1054517737 8 Left 1054517728 9:66053067-66053089 CCCTAGACCAGCCTCCCACACAG 0: 7
1: 3
2: 0
3: 38
4: 302
Right 1054517737 9:66053098-66053120 GTCTCTTCCATTTACCTTCAGGG 0: 4
1: 0
2: 4
3: 24
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054517737 Original CRISPR GTCTCTTCCATTTACCTTCA GGG Intergenic
902387813 1:16085780-16085802 GTCACTTCCTCTTCCCTTCAAGG + Intergenic
902845889 1:19110464-19110486 GTCTCTTCCCATTGCCTTCTAGG - Exonic
902913552 1:19620843-19620865 GTCTCTTCTATTTTCCCCCAAGG - Intronic
903197524 1:21702482-21702504 GCCTCTTCCATTGACCTGCAAGG - Intronic
906873028 1:49504823-49504845 ATCTAATCCATTTACATTCAAGG + Intronic
908160091 1:61398443-61398465 GTCTATTCCATTTGAATTCAGGG - Intronic
909689633 1:78392843-78392865 ATCTAGCCCATTTACCTTCAAGG + Intronic
910250497 1:85193029-85193051 GCCTTTTCCATTTACCAACAAGG - Intronic
910288480 1:85578751-85578773 GTCTTTTCTATTTGACTTCATGG - Intergenic
911990635 1:104692806-104692828 GTGTTTTTCATTTTCCTTCAAGG - Intergenic
913123074 1:115759781-115759803 CCCACTTCCATCTACCTTCAGGG + Intronic
913334937 1:117700719-117700741 GCTTTTTCCATTTACCATCAGGG - Intergenic
914780190 1:150778740-150778762 GCCTCTTCCATTTACTAGCAAGG - Intergenic
914847408 1:151290694-151290716 GTTTCTTCCACTTTTCTTCAGGG + Exonic
915056486 1:153136020-153136042 GTTTAATCCATTTACATTCAAGG - Intergenic
916389226 1:164312373-164312395 CTCTCTTTCATTTACTCTCAGGG + Intergenic
917225441 1:172776694-172776716 TTCTCTTCCCTTTACCTTACTGG + Intergenic
918616646 1:186551462-186551484 ATTTAATCCATTTACCTTCAAGG + Intergenic
918621631 1:186612151-186612173 GTCTCCTGCAGTTCCCTTCATGG + Intergenic
920797168 1:209150656-209150678 GTTTCTTCCTTGTTCCTTCAGGG + Intergenic
1063742277 10:8837130-8837152 GTATCTACCATCTACCATCATGG + Intergenic
1065377897 10:25061344-25061366 TTCTGTTCCATTTTGCTTCATGG + Intronic
1065678550 10:28205223-28205245 GTCTATATTATTTACCTTCATGG - Intronic
1066166426 10:32793000-32793022 ATTTATTCCATTTACATTCAAGG - Intronic
1068165814 10:53331273-53331295 GTCTCTTTAATGTACCTTGATGG - Intergenic
1072501700 10:96024154-96024176 GTTTCTTCCAGTTCCCTTCCTGG - Intronic
1075857943 10:125646817-125646839 GTCTTTTCCATTTATTTTTATGG - Intronic
1077964592 11:7115187-7115209 TTGTATTCCATTTCCCTTCATGG - Intergenic
1079748038 11:24157568-24157590 GTTTAGTCCATTTACATTCAGGG - Intergenic
1079869347 11:25777665-25777687 TTCTCTTCCTCTCACCTTCATGG + Intergenic
1083099392 11:60287312-60287334 CTCACTTCCACTTTCCTTCATGG - Intronic
1085638398 11:78175652-78175674 GTCATTTCCATCTATCTTCAAGG + Intronic
1085888284 11:80546473-80546495 GTTTAGTCCATTTACATTCAAGG - Intergenic
1086290199 11:85300190-85300212 TTCACTTCCAATTATCTTCATGG + Intronic
1086408956 11:86524778-86524800 GTCTCTTACATTTGCTTCCAGGG - Intronic
1087624674 11:100582956-100582978 ATCTTTTCCAATTTCCTTCAAGG + Intergenic
1088362385 11:109004550-109004572 GTCTCTCCCATTTCCATTCTGGG - Intergenic
1088585406 11:111356432-111356454 GTCTCTTCCATTTCCCTCCAGGG - Intronic
1088604839 11:111518810-111518832 CTCTTCCCCATTTACCTTCAAGG + Intronic
1089035750 11:115388792-115388814 GTCTCTTCAATCTACTTTAATGG - Intronic
1089440350 11:118510833-118510855 GAATCTTCTATTTATCTTCATGG - Intronic
1090483440 11:127088399-127088421 GTTTAGACCATTTACCTTCAAGG - Intergenic
1091188786 11:133671820-133671842 GTCTGTTCCAATTACCTTTTTGG - Intergenic
1091442393 12:521537-521559 GTTTCTTCCAGTTACCATCATGG - Intronic
1091911824 12:4238473-4238495 GTTTAATCTATTTACCTTCAAGG + Intergenic
1094738937 12:33266222-33266244 GTCTTTTACAATTACCTACATGG + Intergenic
1095397755 12:41780024-41780046 GTCTCTTCCATGTGCCTTTCAGG + Intergenic
1095870125 12:47017850-47017872 CTTTCTTTCATTTTCCTTCAGGG + Intergenic
1097455110 12:59790585-59790607 GTCTCCTCCATGTATTTTCATGG + Intergenic
1098285256 12:68900717-68900739 GTTTCCTCCATGTATCTTCATGG - Intronic
1099192362 12:79573630-79573652 ATTTAATCCATTTACCTTCAGGG - Intergenic
1099587912 12:84545014-84545036 TTCTTTTCCCTTTACCTTCTGGG + Intergenic
1099709902 12:86210640-86210662 ATCACTTACATTTACCTTTAAGG + Intronic
1100467484 12:94859682-94859704 GTATCTTCCCTTTATCTTCTTGG - Intergenic
1102025576 12:109712633-109712655 GTCTTGGCCATTTACCTTCACGG - Intergenic
1102701151 12:114840455-114840477 GGCTCTGCCCTTTACCATCATGG - Intergenic
1105063478 12:133175436-133175458 ATTTATTCCATTTACATTCAAGG - Intronic
1105256103 13:18744866-18744888 GTCTCCTACCCTTACCTTCAGGG + Intergenic
1105478753 13:20753906-20753928 GTGTAATCCATTTACATTCAAGG + Intronic
1107223791 13:38021202-38021224 GTTTAATCCATTTACATTCAAGG + Intergenic
1108441623 13:50459301-50459323 GATTCTTCCATGTACCTACAGGG + Intronic
1109629640 13:65029938-65029960 GTTTAATCCATTTACATTCAAGG + Intergenic
1111496690 13:89060175-89060197 GTTTCCACCATTTACATTCAAGG + Intergenic
1114350206 14:21841964-21841986 GTATCTTTCATTTTTCTTCAGGG - Intergenic
1115017139 14:28631592-28631614 GTTTTTCCCATTTACATTCAGGG + Intergenic
1116119797 14:40707767-40707789 GTTTAGTCCATTTACATTCAAGG - Intergenic
1116467074 14:45246217-45246239 AACTCTTACATTTACCTACAAGG + Intronic
1116557673 14:46333539-46333561 GACTATTCAATATACCTTCAAGG + Intergenic
1118764306 14:68899760-68899782 GTCTCTCCCCTTCTCCTTCAGGG - Intronic
1119606076 14:76018984-76019006 GTTTAATCCATTTACATTCAAGG + Intronic
1119952034 14:78755040-78755062 TGCTCTTCCATTTACTCTCATGG + Intronic
1120205888 14:81587256-81587278 TTCACTTCCCATTACCTTCAAGG - Intergenic
1202835907 14_GL000009v2_random:77162-77184 GTCTCCTACCTTTACCTTCAGGG - Intergenic
1124331973 15:28827899-28827921 TTCTCTTGCATTTCACTTCATGG + Intergenic
1125662937 15:41408357-41408379 GTCTCTTCCAGTAGCCTCCAAGG - Intergenic
1126219418 15:46195632-46195654 GTTTATTCCATTTACATTTAAGG + Intergenic
1127583616 15:60360926-60360948 CTCACATGCATTTACCTTCATGG + Exonic
1127645984 15:60959836-60959858 GTCTCTACCATAAACCTTTATGG - Intronic
1130718626 15:86363521-86363543 CTCTCTTCCCTTGACCTCCATGG + Intronic
1131788363 15:95937319-95937341 GTCTCTGCCTTTTAGCTTCCTGG + Intergenic
1132412225 15:101590242-101590264 GTCTCTTCCATGTCTTTTCATGG - Intergenic
1133127851 16:3657768-3657790 GGCTCTTCCCTTTAACTTCCAGG + Exonic
1134643933 16:15851446-15851468 GGGTCTTGCATTTACCTTCCAGG - Intronic
1135175309 16:20222393-20222415 GGCTCTGCCATTCACCCTCATGG + Intergenic
1138166786 16:54809476-54809498 GAATCTGCCATTTAGCTTCAAGG - Intergenic
1140250849 16:73293029-73293051 GTCTCTTCCCTTTTGTTTCAAGG - Intergenic
1140265149 16:73414221-73414243 GTCCCTTTCATTTACCTTTCAGG - Intergenic
1140330070 16:74047854-74047876 GACTCTTACAGTTACCTTCAAGG + Intergenic
1141006407 16:80356931-80356953 GCTTCTTCCACTTACCATCATGG - Intergenic
1141731523 16:85826067-85826089 ATCTCTTCCATGGACCTTCAAGG + Intergenic
1141735681 16:85850930-85850952 GTCTTTTCCCTTTTTCTTCAAGG - Intergenic
1141821141 16:86446820-86446842 GTGTGTGCCATGTACCTTCAAGG + Intergenic
1143579997 17:7819878-7819900 TTCTCTTCCCTCTTCCTTCAGGG + Intronic
1144639619 17:16930361-16930383 GGCTCTTCCCTTCACCTCCAGGG + Intronic
1149491518 17:57088172-57088194 GTTTCTTCCATGTTCCTTCCTGG + Intronic
1150192388 17:63257127-63257149 GTTTATTCCATTTACGTTCAAGG + Intronic
1150615758 17:66769877-66769899 GTCTCTTCCATTTATCTTAGTGG - Intronic
1154097862 18:11435810-11435832 GTTTAATCCATTTACATTCAAGG - Intergenic
1154434930 18:14335812-14335834 GTCTGCTACCTTTACCTTCAGGG - Intergenic
1155715462 18:28937390-28937412 GTTTCTTCCATTTTCCATAAGGG - Intergenic
1156851059 18:41726596-41726618 TTCCCTTCCATTTACCTTGTTGG - Intergenic
1157637135 18:49169699-49169721 GTCTCTACCATGGAACTTCAGGG + Intronic
1158575906 18:58637710-58637732 GTCCCTACCATTTACTTTTATGG + Intergenic
1159813544 18:73045420-73045442 GTGGCTTCCATTTTCCTCCATGG + Intergenic
1159931596 18:74317672-74317694 ATCCCTGCCATTTACCTTTAAGG - Intronic
1163693248 19:18749144-18749166 GGCTCTTCCCTCTACCTCCAGGG - Intronic
1164372410 19:27654026-27654048 TTCTCTCCCATTTAAATTCATGG + Intergenic
1164381995 19:27743542-27743564 GTCTCTTCCATTAAAATGCATGG + Intergenic
1164385195 19:27765931-27765953 GTCTCTTCCATTAAAATTCTGGG + Intergenic
1164470244 19:28523967-28523989 GTCTCTTCCTTGTCCCTTCCAGG + Intergenic
1167002177 19:46752271-46752293 GTCTCTTGCTGTGACCTTCAAGG + Intronic
925504073 2:4541535-4541557 GTCTCTTCCATTGACCTTAAGGG - Intergenic
926940003 2:18125649-18125671 GTCTCTCTCATTTATCTTAAGGG - Intronic
926942568 2:18153831-18153853 GTCTCTCTCATTTGCCTTCCTGG - Intronic
928207226 2:29294255-29294277 TTCTCTTCCCTCTTCCTTCAGGG - Intronic
928485811 2:31729730-31729752 TTCTCTTTCACTTTCCTTCAAGG - Intergenic
929487096 2:42364376-42364398 GTATGTTCCATTTTCCCTCAGGG - Intronic
933402958 2:81821996-81822018 CTGTTTTCTATTTACCTTCAAGG + Intergenic
938142679 2:128809529-128809551 GTCTTTTCTGTTTACCTGCATGG - Intergenic
938279014 2:130051646-130051668 GTCTCTTATCTTCACCTTCAGGG + Intergenic
938329997 2:130442522-130442544 GTCTCTTATCTTCACCTTCAGGG + Intergenic
938359948 2:130678981-130679003 GTCTCTTATCTTCACCTTCAGGG - Intergenic
938762083 2:134435155-134435177 GTGTCTTCCATCTTACTTCATGG + Intronic
940520826 2:154745698-154745720 GTCTTTAACATTTATCTTCATGG + Intronic
941028840 2:160489068-160489090 ATCTTTTCCTTTTCCCTTCAAGG + Intronic
941123788 2:161561934-161561956 CTCTCTCCCAGTTGCCTTCACGG - Intronic
944278550 2:197868225-197868247 GTCTTTTCCATTTAAATACATGG + Intronic
944289067 2:197983977-197983999 GAATCTTCCATATGCCTTCAAGG + Intronic
944740986 2:202612552-202612574 ATCTCTTGAATTTACCTTCTGGG - Intergenic
944801359 2:203240219-203240241 GTCTAATCCATTTACCTGCTCGG - Intronic
945250998 2:207766888-207766910 GTCACTTCCGTTTACCTTCATGG - Exonic
945970935 2:216231333-216231355 GTTTAATCCATTTACATTCAAGG + Intergenic
946808055 2:223492060-223492082 GTCCCTTCCCTCTATCTTCAAGG + Intergenic
1168733222 20:105489-105511 GTTTAGTCCATTTACATTCATGG - Intergenic
1169855301 20:10095460-10095482 TTCTCTCTCATTTACATTCAAGG - Intergenic
1169961168 20:11161756-11161778 GTCTCTTCTATTCACTTTCGTGG + Intergenic
1171880840 20:30616617-30616639 ATCTCTTACCTTCACCTTCAGGG + Intergenic
1171882857 20:30631131-30631153 GTCTCCTACCTTTACCTTCAGGG + Intergenic
1173793764 20:45844419-45844441 CCCTCTTCCCTTTACTTTCAGGG - Exonic
1174553167 20:51375853-51375875 GTGTCTTCCATTTGCCCTCCAGG - Intergenic
1175398176 20:58682017-58682039 GTCTCTGCCATTTGACTCCATGG - Intronic
1175757818 20:61540753-61540775 GTTTCTTCCATGCAGCTTCAAGG + Intronic
1176842105 21:13849890-13849912 GTCTCCTACCTTTACCTTCAGGG + Intergenic
1178217402 21:30615285-30615307 TTCTCTTCCCTTCAGCTTCAAGG - Intergenic
1179340386 21:40502654-40502676 GTCTCTTCCTTCTACTTTTAAGG + Intronic
1179792078 21:43761578-43761600 GGCGCTTCCATCCACCTTCACGG - Exonic
1180105718 21:45616984-45617006 GTCTCTGCCCTTTCCCATCAGGG + Intergenic
1181429224 22:22867772-22867794 GTCTCTTTCATCCACCTTGAGGG + Intronic
1181874539 22:25929960-25929982 GTTTCTTCCCTTGACCTACACGG + Intronic
1183849052 22:40568320-40568342 GGCTCTTCAAGTTACCTTCATGG + Intronic
1183998365 22:41653434-41653456 TTCTCTTCCATTTTCTTTAAAGG - Intronic
1185143611 22:49117367-49117389 CTCACTTCCTCTTACCTTCAAGG + Intergenic
949297793 3:2546804-2546826 TTTTCTTCCATTTATCTTAAAGG - Intronic
949720972 3:6989944-6989966 GTTGCTTCCCTTTATCTTCAGGG + Intronic
949889905 3:8725986-8726008 GTGTCATTCATTTACCTTGAGGG + Intronic
951969048 3:28422519-28422541 GTCTCTTCCATGTCCTTTTATGG + Intronic
953045140 3:39288374-39288396 GTCTCTACCCTTTCCCTTAATGG + Intergenic
957896076 3:86422390-86422412 CTCTATTCCATCTACCTTCTAGG + Intergenic
959331702 3:105013985-105014007 GTCCCTTTCATTAACCTGCAGGG - Intergenic
959820699 3:110731507-110731529 GCCTCTTACATTTGCCTTTAGGG - Intergenic
959872042 3:111340037-111340059 GTCTCTTGCAGCTACCTACAGGG + Intronic
961513460 3:127418710-127418732 GTCTCTACCATTTACCCACTGGG - Intergenic
961581839 3:127889656-127889678 GTCTTTTCCAATGACCTACAAGG + Intergenic
962260595 3:133901041-133901063 ATGTCTTCCATTTATGTTCATGG + Intergenic
963046051 3:141103464-141103486 GTCTTTTCCATTCATTTTCAGGG - Intronic
966740568 3:183229466-183229488 GTCTCTTCCCTTTCTCTCCAGGG + Intronic
967748839 3:193090391-193090413 GTTTATTCCATTTACATCCAGGG - Intergenic
970251208 4:14117884-14117906 GGCTTTTCCATTAACCATCAGGG - Intergenic
973394071 4:49578864-49578886 GTCTCCTACTTTTACCTTCAGGG - Intergenic
975439492 4:74394733-74394755 GTCACTTCCATTTTCTTTCATGG - Intergenic
976984648 4:91278665-91278687 GTTTAATCCATTTACCTTCAAGG + Intronic
979822310 4:125189999-125190021 CTTTCTTCCATTCACCTTCTGGG - Intergenic
980863262 4:138523922-138523944 GTTTAATCCATTTACATTCATGG - Intergenic
981752357 4:148104576-148104598 GTCTCTTACATACACATTCATGG + Intronic
982312996 4:154004786-154004808 GTCTCTAGCAATTACCTTCATGG + Intergenic
984025797 4:174541830-174541852 GTCTCTTTCTTTTACTATCATGG - Intergenic
984880790 4:184408473-184408495 GCTCCTTCCATTTTCCTTCAAGG + Intronic
1202764045 4_GL000008v2_random:136072-136094 GTCTCCTACCTTTACCTTCAGGG + Intergenic
986355923 5:6926164-6926186 GGCTCCTCCATATTCCTTCACGG + Intergenic
986427519 5:7649630-7649652 TTCTCTGCCATTTACCCTTAGGG + Intronic
987140754 5:14943614-14943636 TTCACTTCCTTGTACCTTCAAGG - Intergenic
987837927 5:23185955-23185977 ATGTCTTCAATTCACCTTCAGGG + Intergenic
988775513 5:34474917-34474939 CTCTCTTCCATTTAACCCCAGGG + Intergenic
989751493 5:44899664-44899686 ATCTCTTCCTTTACCCTTCAGGG - Intergenic
989793508 5:45437513-45437535 GTCTCATCCATTCACATTCATGG + Intronic
990369485 5:55102784-55102806 GTCTGCTCCATTTTGCTTCATGG - Intronic
990484832 5:56247976-56247998 TTCTCTTCCATTAACCTTCTTGG - Intergenic
991093711 5:62717865-62717887 CCCTCTTCCATTTGCCTACAAGG - Intergenic
991116386 5:62960723-62960745 CCCTCTTCCCTGTACCTTCATGG + Intergenic
991508121 5:67346194-67346216 GTTTAATCCATTTACATTCAAGG - Intergenic
991575165 5:68095376-68095398 CTCTCATCCATGAACCTTCAAGG - Intergenic
993846541 5:92951558-92951580 GTTTTATCCATTTACATTCAGGG + Intergenic
994833420 5:104815883-104815905 ATTTCTTGCATTTACCTCCATGG - Intergenic
995636518 5:114199399-114199421 ATTTAATCCATTTACCTTCAAGG + Intergenic
995745600 5:115399512-115399534 GTTTCATCCATGTACCTGCAAGG + Intergenic
1004032911 6:11889092-11889114 TTATCTTTCCTTTACCTTCATGG + Intergenic
1007958764 6:45940201-45940223 GTCTCATGCATTTACCCCCATGG + Intronic
1010216527 6:73407505-73407527 GTCTATTCCTTTGACCTTTAAGG - Exonic
1011814443 6:91171948-91171970 TTTTCTTCCATTTCCCTCCATGG + Intergenic
1012586663 6:100931642-100931664 ATTTATTCCATTTACATTCAAGG + Intergenic
1015082719 6:129247527-129247549 GTCTTTTTCATTTACCCTAAAGG - Intronic
1015722117 6:136253370-136253392 GGCTGTTCCAATTACTTTCAGGG + Intergenic
1018534087 6:164800606-164800628 GTCACATGCACTTACCTTCAAGG - Intergenic
1020599526 7:10254498-10254520 GTCTCTTGCATGTTCCCTCAAGG - Intergenic
1020762374 7:12284242-12284264 GTGTCTTCCATTGTCTTTCATGG + Intergenic
1020831065 7:13096313-13096335 TTCTCTCTCATTTACCTTTATGG + Intergenic
1021215902 7:17914882-17914904 GTTTATTCCATTTACATTCAAGG - Intronic
1021595828 7:22315469-22315491 GTCTTTTCCATTTAGATTTATGG - Exonic
1024095236 7:45977497-45977519 CTCTTCTCCATTTACCTCCAAGG + Intergenic
1024583569 7:50821527-50821549 GTCTCTTTCCTTCTCCTTCAGGG - Intergenic
1025150710 7:56544848-56544870 GTGTAATCCATTTACATTCAAGG - Intergenic
1026246996 7:68629637-68629659 GTTTCTTCCATGTATTTTCATGG - Intergenic
1027733098 7:81901179-81901201 GTCTCCTCCATTAACCTTAAAGG - Intergenic
1028184986 7:87772775-87772797 GTTTCTGCCATTTACTTTTATGG - Intronic
1028487755 7:91378564-91378586 GTGCTTTCAATTTACCTTCACGG + Intergenic
1028563431 7:92201217-92201239 GTGACATCCATTTAACTTCAAGG - Intronic
1034490044 7:151388347-151388369 GTCTCTGCCCTGTCCCTTCATGG - Intronic
1035849347 8:2899755-2899777 GTTTCTTCCATGTCCATTCATGG - Intergenic
1036947440 8:13107640-13107662 GCCTCTTCCAAATACCTTCTTGG - Intronic
1037142072 8:15531978-15532000 GCCACTTCCATTTTGCTTCAGGG + Intronic
1040531405 8:48269363-48269385 ATCTCTTCCATTTACTTTAGGGG - Intergenic
1042160028 8:65883651-65883673 GACTCTTCCATTTACATTAGAGG + Intergenic
1043479745 8:80640869-80640891 GTATCTTCCATTTGACTTCTTGG - Exonic
1044173527 8:89087348-89087370 GTCTCTTACATCGTCCTTCAGGG + Intergenic
1045308471 8:100979970-100979992 GTTTCTTCCACTTCTCTTCATGG - Intergenic
1046577328 8:116047194-116047216 GTCTCTTTTATTTATCTTGAGGG + Intergenic
1048068979 8:131001947-131001969 GTTGCTGCCATTTACCTCCAGGG + Intronic
1048500052 8:134967344-134967366 TTCTCTTTCATTTACCTCAATGG + Intergenic
1050044268 9:1527079-1527101 CACTCTTCCATATACATTCAGGG + Intergenic
1051336859 9:16073542-16073564 GTCTCTTCCATTTAGGTTAGTGG + Intergenic
1051961893 9:22775990-22776012 TTCTCTTTCATTTCCCTTCTAGG + Intergenic
1052199506 9:25761347-25761369 CTCTCTTTTATTTTCCTTCAGGG - Intergenic
1052880658 9:33599373-33599395 GTCTCTTAGCTCTACCTTCAGGG - Intergenic
1053291705 9:36884010-36884032 GCCTCATCCATTTAGCTTCTTGG + Intronic
1053386247 9:37692630-37692652 AGCTCTTCCATTTACCTAAAAGG - Exonic
1053495315 9:38544837-38544859 GTCTCTTAGCTCTACCTTCAGGG + Intronic
1053666872 9:40323185-40323207 GTCTCTTCCATTTACCTTCAGGG - Intronic
1053916464 9:42948292-42948314 GTCTCTTCCATTTACCTTCAGGG - Intergenic
1054378024 9:64463213-64463235 GTCTCTTCCATTTACCTTCAGGG - Intergenic
1054517737 9:66053098-66053120 GTCTCTTCCATTTACCTTCAGGG + Intergenic
1055435999 9:76292845-76292867 TTCTCTTTCATTTTCCTTCTAGG - Intronic
1055479443 9:76695396-76695418 GTCTGTTCAATTTTCCTTCTTGG - Intronic
1055985914 9:82056474-82056496 GTCTCTTACATTTACCTTGAGGG - Intergenic
1056045181 9:82707178-82707200 CTCCTTTCAATTTACCTTCAGGG + Intergenic
1056063688 9:82911065-82911087 GACTTTTCCATTTCCCTTGATGG + Intergenic
1058083618 9:100725154-100725176 GTCTCTTCCAATTGCCTCCTAGG - Intergenic
1058104358 9:100953734-100953756 GTCTCTTCTATTTAACTTGCAGG + Intergenic
1058449154 9:105080080-105080102 GCATCTGTCATTTACCTTCATGG + Intergenic
1061052529 9:128204760-128204782 CTTTCTTCCAATGACCTTCAGGG + Intronic
1203544794 Un_KI270743v1:120945-120967 GTCTCCTACCTTTACCTTCAGGG + Intergenic
1185494032 X:540717-540739 GTCTCTTGTGTTTACCTTTAAGG + Intergenic
1186442356 X:9597095-9597117 CTCTCCTCCTTTTACCATCAGGG - Intronic
1186877688 X:13832676-13832698 GTCTCATCTGTTTACCTTCTAGG + Intronic
1186921364 X:14284709-14284731 GTTTCTTTCATTTACATACAAGG - Intergenic
1187665507 X:21604770-21604792 GCTTATTCCATTTACCTACAGGG + Intronic
1188150000 X:26661372-26661394 GTCTCCTCCATATAATTTCATGG - Intergenic
1188441048 X:30215663-30215685 GTCTCTTCAGTTTACACTCAGGG - Intronic
1188445134 X:30247480-30247502 GTCTCTTCAATTTACACTCAGGG - Intronic
1188901887 X:35743318-35743340 ATCTCTTACATGTACCTTGAAGG + Intergenic
1189579388 X:42389626-42389648 GTCTCCTCCACTAAACTTCATGG - Intergenic
1190067826 X:47254377-47254399 TTCTCCTCTATTTTCCTTCATGG + Intergenic
1190567346 X:51743920-51743942 GTCCCATCCTTTTACCTTGAGGG - Exonic
1191241124 X:58190830-58190852 GTCTCTTCCATTAACATGCCTGG - Intergenic
1191744206 X:64467945-64467967 GTTTCTTCAATTAGCCTTCATGG + Intergenic
1191956063 X:66643522-66643544 CTCTCTTCCCTTGACTTTCATGG + Intergenic
1194245185 X:91502008-91502030 GTTTAGTCCATTTACATTCATGG - Intergenic
1195842224 X:109186664-109186686 GTCTCTTTCACATCCCTTCAGGG + Intergenic
1197128436 X:122975119-122975141 GGCTCTTTCATTTACCTTCTGGG - Intergenic
1197846882 X:130812629-130812651 ATTTCTTTCATTTACATTCATGG - Intronic
1198751819 X:139943913-139943935 GTCTCTTCCATTGTCCTTTATGG + Intronic
1198832904 X:140769934-140769956 TTCTATTCCAGTTACCGTCAAGG + Intergenic
1198874387 X:141207391-141207413 GTAGCTTCCATTTACCTGAAAGG + Intergenic
1199002228 X:142652878-142652900 GGATCTGCCATTTACCCTCAAGG - Intergenic
1199865431 X:151844622-151844644 GTGTCTTGAATTTACATTCAAGG - Intergenic
1200416278 Y:2914728-2914750 TCCTCTTCCATTTACTTTTAAGG - Intronic
1200564157 Y:4743318-4743340 GTTTAGTCCATTTACATTCATGG - Intergenic