ID: 1054517742

View in Genome Browser
Species Human (GRCh38)
Location 9:66053134-66053156
Sequence ATGTCACTCTAAGGCAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 4, 1: 2, 2: 12, 3: 14, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054517734_1054517742 30 Left 1054517734 9:66053081-66053103 CCCACACAGCAGGGACAGTCTCT No data
Right 1054517742 9:66053134-66053156 ATGTCACTCTAAGGCAACCAAGG 0: 4
1: 2
2: 12
3: 14
4: 142
1054517738_1054517742 6 Left 1054517738 9:66053105-66053127 CCATTTACCTTCAGGGCACTGAC No data
Right 1054517742 9:66053134-66053156 ATGTCACTCTAAGGCAACCAAGG 0: 4
1: 2
2: 12
3: 14
4: 142
1054517739_1054517742 -1 Left 1054517739 9:66053112-66053134 CCTTCAGGGCACTGACTGATCCA No data
Right 1054517742 9:66053134-66053156 ATGTCACTCTAAGGCAACCAAGG 0: 4
1: 2
2: 12
3: 14
4: 142
1054517735_1054517742 29 Left 1054517735 9:66053082-66053104 CCACACAGCAGGGACAGTCTCTT No data
Right 1054517742 9:66053134-66053156 ATGTCACTCTAAGGCAACCAAGG 0: 4
1: 2
2: 12
3: 14
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054517742 Original CRISPR ATGTCACTCTAAGGCAACCA AGG Intergenic
900477182 1:2881526-2881548 ATGTCCTTCCAAGGCAACGAAGG - Intergenic
901572580 1:10173707-10173729 AAGTCTCTCTACGGCAACGATGG - Intronic
903026120 1:20430852-20430874 ATGTCCCTCTCAGGCCCCCAGGG - Intergenic
908206519 1:61855850-61855872 ATCTCACTCTAAGCCAAGTATGG - Intronic
910481306 1:87661263-87661285 GTCTCACTCTATGGAAACCAAGG - Intergenic
912701539 1:111881917-111881939 ATGTGACTCTGAGCCAAGCACGG - Intronic
913109910 1:115648483-115648505 TTGTCCCTCAAAGGAAACCATGG - Intronic
915018635 1:152759846-152759868 ATGTCAGTCTAAGACCACCCAGG + Exonic
915888863 1:159752042-159752064 ATGTATCACTCAGGCAACCAAGG - Intergenic
920226667 1:204443991-204444013 ATTTCACTCTTAGGCACGCAAGG - Intronic
923556747 1:235007072-235007094 ATCTCACTCCAAGACAAACAAGG - Intergenic
923787611 1:237083358-237083380 ATGCCACTCTCAGGCAAGCCAGG + Intronic
924838386 1:247678879-247678901 CTGTCAGTCTCAGGCAACCTGGG + Intergenic
1063395984 10:5687773-5687795 GTGTCACTCTACGGCAGCCTGGG + Intronic
1071057582 10:81529258-81529280 ATGTCTATCCAAAGCAACCATGG + Intergenic
1071802919 10:89084549-89084571 ATGTTATTCTGATGCAACCATGG - Intergenic
1076171552 10:128324176-128324198 ATGTCACTCAGCGGCAGCCACGG + Intergenic
1076234729 10:128854598-128854620 ATGACACTCCAAGGACACCAGGG + Intergenic
1077646650 11:3931425-3931447 ATGTCACTCCTTGGTAACCAGGG + Intronic
1081550778 11:44109844-44109866 AAGTCACTCTCAGGCAGTCATGG - Intronic
1085869926 11:80337407-80337429 GTGTCACAGTAAGGCAAACATGG + Intergenic
1091274355 11:134340405-134340427 ATGTGCCTCTGAGGGAACCAGGG + Intronic
1092958052 12:13568431-13568453 CTGTCACTCAAAGGCAATAATGG - Intronic
1093993430 12:25615502-25615524 ATGCCACTCTACTGCAACCTGGG - Intronic
1099308828 12:80993118-80993140 ATGTCACACCAAGGCATCTAGGG - Intronic
1100280681 12:93115513-93115535 ATGTAATTATAAGGCAACTAGGG - Intergenic
1101699414 12:107157996-107158018 ATGTCAGTGTAAGGCATTCAAGG - Intergenic
1104381131 12:128308890-128308912 ATTTCCCTCTATGGAAACCAAGG - Intronic
1105256110 13:18744902-18744924 ATCTCACTCTAAGGCAACCAAGG + Intergenic
1108399557 13:50025942-50025964 ATGACACTCTAAGGAAAAAAGGG + Intergenic
1108784330 13:53876678-53876700 ATATGTCTCTAAGGCAGCCAGGG - Intergenic
1108830971 13:54477795-54477817 ATTTCAGTCTAACGTAACCACGG + Intergenic
1109249485 13:60001772-60001794 ATGCAACTCTTAGGCAACTATGG + Intronic
1110518062 13:76439954-76439976 CTCTCATTCTAAGGCAATCAAGG + Intergenic
1114845533 14:26315947-26315969 ATTTCATTCTAAGGACACCATGG - Intergenic
1202835901 14_GL000009v2_random:77126-77148 ATCTCATTCTAAGGCAACCAAGG - Intergenic
1128542137 15:68543574-68543596 ATGCAACTCTAAGGCCAGCAAGG + Intergenic
1130047199 15:80454485-80454507 ATCTCCCTCTAAGGTAACCCTGG + Intronic
1135738025 16:24948750-24948772 ATGTCACTCAAAACCAAACAAGG + Intronic
1137801806 16:51268338-51268360 CTGTCACTCTGAGGCACTCAGGG + Intergenic
1138765030 16:59591787-59591809 ATATTACTCTAAGGCATACAAGG - Intergenic
1140325212 16:73994802-73994824 CTGTCACTCTAATGCAATAAAGG - Intergenic
1143204439 17:5132379-5132401 GTCTCACTGTAAGGCAACCCAGG - Exonic
1143994007 17:10991159-10991181 AGATCTCTCTAAGGAAACCAAGG + Intergenic
1144494430 17:15737467-15737489 ATCTCACTGTAAGGCAACCCAGG - Exonic
1144639627 17:16930403-16930425 GTCTCACTGTAAGGCAACCCAGG + Intronic
1144905835 17:18639209-18639231 ATCTCACTGTAAGGCAACCCAGG + Exonic
1146160181 17:30555374-30555396 TTCTCACTGTAAGGCAACCCAGG - Intergenic
1146844222 17:36173442-36173464 GTCTCACTGTAAGGCAACCCAGG + Exonic
1146856527 17:36261377-36261399 GTCTCACTGTAAGGCAACCCAGG + Exonic
1146864090 17:36326998-36327020 GTCTCACTGTAAGGCAACCCAGG - Exonic
1146872437 17:36385288-36385310 GTCTCACTGTAAGGCAACCCAGG + Exonic
1146879795 17:36436373-36436395 GTCTCACTGTAAGGCAACCCAGG + Exonic
1147066950 17:37927586-37927608 GTCTCACTGTAAGGCAACCCAGG - Exonic
1147075321 17:37985912-37985934 GTCTCACTGTAAGGCAACCCAGG + Intronic
1147078482 17:38007147-38007169 GTCTCACTGTAAGGCAACCCAGG - Intronic
1147086846 17:38065458-38065480 GTCTCACTGTAAGGCAACCCAGG + Exonic
1147094420 17:38131082-38131104 GTCTCACTGTAAGGCAACCCAGG - Intergenic
1147102791 17:38189421-38189443 GTCTCACTGTAAGGCAACCCAGG + Intergenic
1147715400 17:42504246-42504268 ATATCACTCACAGACAACCAAGG - Intronic
1148877783 17:50701908-50701930 ATGTCACTCTGAGACATCAATGG - Intronic
1149083482 17:52685802-52685824 ATGACACTCTATGGCTAACAGGG - Intergenic
1149847364 17:60015888-60015910 GTCTCACTGTAAGGCAACCCAGG + Intergenic
1150085723 17:62272505-62272527 GTCTCACTGTAAGGCAACCCAGG + Exonic
1150755418 17:67907866-67907888 AGGTATCTCTAAGACAACCAGGG - Intronic
1154434925 18:14335776-14335798 ATCTCAGTCTAAGGCAACCGTGG - Intergenic
1155670727 18:28367909-28367931 ATTTTACTCTAAAGCAGCCATGG - Intergenic
1157587227 18:48811331-48811353 ATTTAACTCTGAGGAAACCATGG - Intronic
1159756767 18:72375584-72375606 ATGTGACTCTGAGGTAAACAGGG - Intergenic
1163233994 19:16020571-16020593 GTCTCACTGTAAGGCAACCCAGG - Intergenic
1167345940 19:48945782-48945804 AAGTCACTCCAAGGCAATGAGGG - Intergenic
1202636735 1_KI270706v1_random:50237-50259 ATCTCATTCTAAGGCAACCAAGG + Intergenic
928946913 2:36779799-36779821 AAGTCACTCTTAGAAAACCAGGG - Intronic
929613569 2:43290397-43290419 CTGTCACTCAAAGGCAAGCCAGG - Intronic
930708226 2:54525224-54525246 ATGTAAGTGTATGGCAACCAAGG - Intronic
931558399 2:63530548-63530570 ATGTCACTTTAAGGTAATTAAGG + Intronic
931786262 2:65621902-65621924 ATGTCACCCTGAGTCCACCAAGG - Intergenic
932268780 2:70390807-70390829 ATGTCATTTCAAGGCCACCAGGG + Intergenic
934491109 2:94762531-94762553 ATCTCACTCTAAGGCAATCAAGG + Intergenic
934575385 2:95397376-95397398 TTCTCAGTGTAAGGCAACCAAGG + Intergenic
934783773 2:96989850-96989872 ATGTCACTCCAAAGCGACAATGG - Intronic
937402932 2:121600882-121600904 ATGGCATTCAAAGGCAATCACGG + Intronic
937955849 2:127421442-127421464 ATGACACAGTAAGGCCACCATGG + Exonic
938330000 2:130442558-130442580 ATCTCACTCTAAGCCAATCGAGG + Intergenic
938359945 2:130678945-130678967 ATCTCACTCTAAGCCAATCGAGG - Intergenic
940902000 2:159134232-159134254 AAGCCACTTTAAGGCAACCAAGG + Intronic
944823502 2:203456417-203456439 ATGTGACTCTAAGACAAAGAGGG + Intronic
944976922 2:205064513-205064535 ATGGCACTTTAAATCAACCATGG + Intronic
945201270 2:207284209-207284231 TTTTCAGTCTAATGCAACCATGG + Intergenic
1171022643 20:21600598-21600620 ATCACATTGTAAGGCAACCATGG - Intergenic
1171819586 20:29822580-29822602 ATGTTAATCCAAGGCAACCAAGG - Intergenic
1171880845 20:30616653-30616675 TTCTCACTCTGAGGCAACAAAGG + Intergenic
1171882863 20:30631167-30631189 ATCTCATTCTAAGGCAACCAAGG + Intergenic
1171898236 20:30830602-30830624 ATGTTAATCCAAGGCCACCAAGG + Intergenic
1174926412 20:54765102-54765124 CTGTTACTCTAGGGCCACCAAGG - Intergenic
1174971422 20:55280334-55280356 ATGTCTCTCTTAGGCTACCTAGG + Intergenic
1175214392 20:57383673-57383695 AGGTCACTGTAAGGCAAATATGG + Intergenic
1176842111 21:13849926-13849948 ATCTCACTCTAAGGCAACCAAGG + Intergenic
1179043637 21:37826715-37826737 ATGTTACTCTAAGGCCATCAAGG - Intronic
1181632740 22:24159794-24159816 ATGACACCCTGAGGCACCCATGG + Intronic
952229758 3:31417612-31417634 CTGACACTCTAAAGCAACAATGG + Intergenic
955105916 3:55897791-55897813 GTGTCACTCTAAGGCAGCAGTGG - Intronic
961543238 3:127614841-127614863 AAATCACTCAAAGACAACCAGGG - Intronic
964610469 3:158609947-158609969 ATGTCACTCAAAGGGGACAACGG - Intergenic
965419617 3:168441637-168441659 ATGACATTATAAGACAACCAAGG - Intergenic
968282003 3:197484418-197484440 AAGGCACTCTAAGGCAGGCATGG - Intergenic
968350080 3:198046483-198046505 TTCTCATTCTAAGGCAACCAAGG + Intergenic
971028172 4:22608668-22608690 ATGTCACTGAGAGGCAAGCATGG - Intergenic
971172170 4:24244622-24244644 CTGTCACACTAAATCAACCAGGG + Intergenic
972597992 4:40547102-40547124 ATGTCACTAAAAGGGAACCCAGG - Intronic
972665190 4:41158545-41158567 ATGTCATTCTAATGCACACATGG + Intronic
973366542 4:49213571-49213593 ATCTCATTCTAAGGCAACCAAGG + Intergenic
973394067 4:49578828-49578850 ATCACATTCTAAGGCAACCAAGG - Intergenic
974850828 4:67403499-67403521 AGGTCAGTCCAAGCCAACCAGGG + Intergenic
975588329 4:75974075-75974097 ATGTTTCTCTAAGGTCACCAAGG - Exonic
975745375 4:77470132-77470154 CTGGCACCCTGAGGCAACCATGG + Intergenic
979033392 4:115680003-115680025 ATGTTAATCTCAGACAACCAGGG - Intergenic
979793939 4:124820272-124820294 ATGTCATTGTTAGGCAAACAAGG - Intergenic
982296645 4:153835802-153835824 AGGTAAATCAAAGGCAACCAAGG - Intergenic
983123073 4:163912729-163912751 ATGCCACTCTTATGCAGCCACGG - Intronic
983246085 4:165289050-165289072 AAGTCACTCTAAGGCATGCATGG - Intronic
1202764050 4_GL000008v2_random:136108-136130 ATCTCATTCTAAGGCAACCAAGG + Intergenic
987257323 5:16169351-16169373 AAGGCACACTAAGGCAACAATGG + Intronic
989505621 5:42223999-42224021 ATGTAACTCTCAGGTAACCTTGG - Intergenic
990010015 5:50986330-50986352 GTGTAACTCTAAGGTCACCAAGG + Intergenic
990575185 5:57117120-57117142 ATGTCACACTCAGGCTACCAAGG + Intergenic
992011030 5:72527819-72527841 AGGCCAGGCTAAGGCAACCATGG - Intergenic
1000409169 5:160919688-160919710 ATGTCAATGGAAGGGAACCAGGG + Intergenic
1000950213 5:167472571-167472593 CGGTCACTCTAAGGCAACCAAGG - Intronic
1001035507 5:168293333-168293355 AGGTCCCTGTAAAGCAACCAAGG + Intronic
1001731892 5:173966429-173966451 ATCTCATTTTAAGGCGACCAAGG + Intergenic
1002829786 6:809417-809439 ATGACACTCAAATGCAAGCATGG + Intergenic
1007034805 6:38663366-38663388 ATGTCTCTCCAAGGCAAGCCAGG - Intergenic
1010869663 6:81021814-81021836 ATGTCACTCTAAGGCCAAATTGG - Intergenic
1012181413 6:96157555-96157577 ATGACATTTGAAGGCAACCATGG + Intronic
1023333670 7:39146256-39146278 ATGTGACTGTAATGGAACCATGG + Intronic
1026973682 7:74483119-74483141 ATGTCCATCTAGGGAAACCACGG - Intronic
1027423052 7:78035609-78035631 ATCTCACTTTAAGGAAACAAGGG - Intronic
1028317014 7:89415272-89415294 ATGTCTAGCTAAGGTAACCAGGG - Intergenic
1035069137 7:156128099-156128121 CTGTCTCCCTAAGGGAACCAGGG + Intergenic
1036649051 8:10630426-10630448 ATGTCACTCTCAGCCAGCCTGGG + Intronic
1037202049 8:16267006-16267028 AAGTAATTATAAGGCAACCATGG - Intronic
1037650068 8:20828350-20828372 ATTTCACTATAAGGTAAGCAGGG - Intergenic
1039820047 8:41126982-41127004 ATTTCAATCTAGTGCAACCAGGG + Intergenic
1040105187 8:43537660-43537682 ATCTCATTCTAAGGCAACCAAGG - Intergenic
1040829953 8:51665128-51665150 ATGTCTCTCTAAGGAAAGGAAGG - Intronic
1047021612 8:120781028-120781050 GCTTCACTCTAAGGAAACCAGGG - Intronic
1051483199 9:17580414-17580436 CTGTCACCCTAAGTTAACCAAGG - Intronic
1052092909 9:24351608-24351630 CTGTCAATCAAAGGTAACCAAGG - Intergenic
1052880654 9:33599337-33599359 TGCTCACTCTAAGGCAACCAAGG - Intergenic
1053495319 9:38544873-38544895 TGCTCACTCTGAGGCAACCAAGG + Intronic
1053666867 9:40323149-40323171 ATGTCACTCTAAGGCAACCAAGG - Intronic
1053750811 9:41252399-41252421 ATGTTAATCCAAGGCCACCAAGG + Intergenic
1053916459 9:42948256-42948278 ATGTCACTCTAAGGCAACCAAGG - Intergenic
1054256326 9:62816742-62816764 ATGTTAATCCAAGGCCACCAAGG + Intergenic
1054378019 9:64463177-64463199 ATGTCACTCTAAGGCAACCAAGG - Intergenic
1054517742 9:66053134-66053156 ATGTCACTCTAAGGCAACCAAGG + Intergenic
1055985911 9:82056438-82056460 TTCTCACTCTACAGCAACCAAGG - Intergenic
1056585429 9:87924692-87924714 TTCTCACTCTAAGGCAACCAAGG + Intergenic
1056611450 9:88128251-88128273 TTCTCACTCTAAGGCAACCAAGG - Intergenic
1056712613 9:89002896-89002918 ATGTCAGTCTAAGGAGACCAGGG - Exonic
1057675216 9:97132231-97132253 ATCTCACTCTAAAGCAACCAAGG + Intergenic
1059983070 9:119794543-119794565 ATGTCACACGAAGCCAAGCATGG - Intergenic
1203544799 Un_KI270743v1:120981-121003 ATCTCATTCTAAGGCAACCAAGG + Intergenic
1187996183 X:24929413-24929435 ATGTCATTCCAAGGCAGCAAGGG + Intronic
1189213875 X:39306752-39306774 CTGTCACTCCAAGCCAACCGGGG - Intergenic
1191701220 X:64044495-64044517 ATGACACTCTGAAGCAACGACGG + Intergenic
1192810985 X:74547243-74547265 AGGTCAGTCTAAGCCAGCCAAGG - Intergenic
1195222291 X:102757021-102757043 AGGTGATTCTAATGCAACCAGGG - Intergenic
1198630808 X:138636256-138636278 ATGTTACTGTAAGGCAAGGATGG - Intronic
1200407372 Y:2826897-2826919 ATGTCACTCTACACAAACCATGG - Intergenic
1201067088 Y:10107238-10107260 ATGTTAATCCAAGGCTACCAAGG + Intergenic
1201760780 Y:17536088-17536110 ATGTGAATCCAAGGCAACCAAGG - Intergenic
1201840772 Y:18369902-18369924 ATGTGAATCCAAGGCAACCAAGG + Intergenic