ID: 1054527991

View in Genome Browser
Species Human (GRCh38)
Location 9:66153223-66153245
Sequence ACCTGCTGGCGCGCGCCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054527991_1054527996 -7 Left 1054527991 9:66153223-66153245 CCTAGAGGCGCGCGCCAGCAGGT No data
Right 1054527996 9:66153239-66153261 AGCAGGTGGGGCTGCAGCTCCGG No data
1054527991_1054528003 25 Left 1054527991 9:66153223-66153245 CCTAGAGGCGCGCGCCAGCAGGT No data
Right 1054528003 9:66153271-66153293 GATGGGCTCGCCGGTTCTCCTGG No data
1054527991_1054527997 -6 Left 1054527991 9:66153223-66153245 CCTAGAGGCGCGCGCCAGCAGGT No data
Right 1054527997 9:66153240-66153262 GCAGGTGGGGCTGCAGCTCCGGG No data
1054527991_1054527999 8 Left 1054527991 9:66153223-66153245 CCTAGAGGCGCGCGCCAGCAGGT No data
Right 1054527999 9:66153254-66153276 AGCTCCGGGCGTGCGCCGATGGG No data
1054527991_1054527998 7 Left 1054527991 9:66153223-66153245 CCTAGAGGCGCGCGCCAGCAGGT No data
Right 1054527998 9:66153253-66153275 CAGCTCCGGGCGTGCGCCGATGG No data
1054527991_1054528004 26 Left 1054527991 9:66153223-66153245 CCTAGAGGCGCGCGCCAGCAGGT No data
Right 1054528004 9:66153272-66153294 ATGGGCTCGCCGGTTCTCCTGGG No data
1054527991_1054528001 16 Left 1054527991 9:66153223-66153245 CCTAGAGGCGCGCGCCAGCAGGT No data
Right 1054528001 9:66153262-66153284 GCGTGCGCCGATGGGCTCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054527991 Original CRISPR ACCTGCTGGCGCGCGCCTCT AGG (reversed) Intergenic