ID: 1054528233

View in Genome Browser
Species Human (GRCh38)
Location 9:66154300-66154322
Sequence CAACCACTATGGCCCCTGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054528233_1054528237 -4 Left 1054528233 9:66154300-66154322 CCGCTCAGGGGCCATAGTGGTTG No data
Right 1054528237 9:66154319-66154341 GTTGAGTTCTCTGTGGAACTGGG No data
1054528233_1054528240 2 Left 1054528233 9:66154300-66154322 CCGCTCAGGGGCCATAGTGGTTG No data
Right 1054528240 9:66154325-66154347 TTCTCTGTGGAACTGGGATGGGG No data
1054528233_1054528241 27 Left 1054528233 9:66154300-66154322 CCGCTCAGGGGCCATAGTGGTTG No data
Right 1054528241 9:66154350-66154372 AACAGCCAGTTCCCGTCCTTTGG No data
1054528233_1054528236 -5 Left 1054528233 9:66154300-66154322 CCGCTCAGGGGCCATAGTGGTTG No data
Right 1054528236 9:66154318-66154340 GGTTGAGTTCTCTGTGGAACTGG No data
1054528233_1054528239 1 Left 1054528233 9:66154300-66154322 CCGCTCAGGGGCCATAGTGGTTG No data
Right 1054528239 9:66154324-66154346 GTTCTCTGTGGAACTGGGATGGG No data
1054528233_1054528238 0 Left 1054528233 9:66154300-66154322 CCGCTCAGGGGCCATAGTGGTTG No data
Right 1054528238 9:66154323-66154345 AGTTCTCTGTGGAACTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054528233 Original CRISPR CAACCACTATGGCCCCTGAG CGG (reversed) Intergenic
No off target data available for this crispr