ID: 1054530906

View in Genome Browser
Species Human (GRCh38)
Location 9:66181705-66181727
Sequence GTTGAACAGCAGAAGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054530906_1054530908 -3 Left 1054530906 9:66181705-66181727 CCTGGCTTCTTCTGCTGTTCAAC No data
Right 1054530908 9:66181725-66181747 AACCCAGGATCCCATGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054530906 Original CRISPR GTTGAACAGCAGAAGAAGCC AGG (reversed) Intergenic
No off target data available for this crispr